Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200762296:

Variant ID: vg1200762296 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 762296
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ATATATGAACAAAGTAATTAAAATAACAGCTGCGGCAGACATGCAGCGCTCCATTCTCTCTCTGTATCAGCTGTATACTTTATGTTGCACGCTCCCTGTG[T/G]
GCATGTTCTATCTTAATTTTCTTCAGTATGTACACGATCTGTGCGTACGTGTAATCCTATACGTTTTATGAATTGCATGTTGTCCAAATGTCTTGGTCCT

Reverse complement sequence

AGGACCAAGACATTTGGACAACATGCAATTCATAAAACGTATAGGATTACACGTACGCACAGATCGTGTACATACTGAAGAAAATTAAGATAGAACATGC[A/C]
CACAGGGAGCGTGCAACATAAAGTATACAGCTGATACAGAGAGAGAATGGAGCGCTGCATGTCTGCCGCAGCTGTTATTTTAATTACTTTGTTCATATAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.20%	7.80%	0.02%	0.00%	NA
All Indica	2759	95.70%	4.30%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	9.70%	90.30%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	95.40%	4.60%	0.00%	0.00%	NA
Indica Intermediate	786	90.60%	9.30%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200762296	T -> G	LOC_Os12g02340.1	3_prime_UTR_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1200762296	T -> G	LOC_Os12g02340.2	3_prime_UTR_variant ; 126.0bp to feature; MODIFIER	silent_mutation	Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1200762296	T -> G	LOC_Os12g02350.1	upstream_gene_variant ; 1495.0bp to feature; MODIFIER	silent_mutation	Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1200762296	T -> G	LOC_Os12g02370.2	downstream_gene_variant ; 4138.0bp to feature; MODIFIER	silent_mutation	Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N
vg1200762296	T -> G	LOC_Os12g02370.4	downstream_gene_variant ; 4138.0bp to feature; MODIFIER	silent_mutation	Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200762296	NA	8.27E-24	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	3.51E-32	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.14E-27	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.47E-26	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	5.55E-15	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	3.36E-17	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	4.23E-17	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.42E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.53E-22	mr1589	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.47E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	2.47E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	9.12E-26	mr1868	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	2.16E-18	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	7.84E-13	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	2.05E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.02E-24	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.43E-34	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.90E-26	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	3.41E-21	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	1.88E-19	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	4.39E-12	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	8.24E-07	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	7.24E-17	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	5.25E-13	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296	NA	4.00E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251