Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200762296:

Variant ID: vg1200762296 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 762296
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATGAACAAAGTAATTAAAATAACAGCTGCGGCAGACATGCAGCGCTCCATTCTCTCTCTGTATCAGCTGTATACTTTATGTTGCACGCTCCCTGTG[T/G]
GCATGTTCTATCTTAATTTTCTTCAGTATGTACACGATCTGTGCGTACGTGTAATCCTATACGTTTTATGAATTGCATGTTGTCCAAATGTCTTGGTCCT

Reverse complement sequence

AGGACCAAGACATTTGGACAACATGCAATTCATAAAACGTATAGGATTACACGTACGCACAGATCGTGTACATACTGAAGAAAATTAAGATAGAACATGC[A/C]
CACAGGGAGCGTGCAACATAAAGTATACAGCTGATACAGAGAGAGAATGGAGCGCTGCATGTCTGCCGCAGCTGTTATTTTAATTACTTTGTTCATATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.80% 0.02% 0.00% NA
All Indica  2759 95.70% 4.30% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 95.40% 4.60% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.30% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200762296 T -> G LOC_Os12g02340.1 3_prime_UTR_variant ; 191.0bp to feature; MODIFIER silent_mutation Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1200762296 T -> G LOC_Os12g02340.2 3_prime_UTR_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1200762296 T -> G LOC_Os12g02350.1 upstream_gene_variant ; 1495.0bp to feature; MODIFIER silent_mutation Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1200762296 T -> G LOC_Os12g02370.2 downstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N
vg1200762296 T -> G LOC_Os12g02370.4 downstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:54.65; most accessible tissue: Zhenshan97 flower, score: 83.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200762296 NA 8.27E-24 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 3.51E-32 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.14E-27 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.47E-26 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 5.55E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 3.36E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 4.23E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.42E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.53E-22 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.47E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 2.47E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 9.12E-26 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 2.16E-18 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 7.84E-13 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 2.05E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.02E-24 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.43E-34 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.90E-26 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 3.41E-21 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 1.88E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 4.39E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 8.24E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 7.24E-17 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 5.25E-13 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200762296 NA 4.00E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251