Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200761930:

Variant ID: vg1200761930 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 761930
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAAACAACAAACTAAACTAACACTACTTAACGTATTTTCGCTATTATATCCGTTATTTTTGTTGCAAGTACAAGTTAAATTTAAACATGTATATTTA[C/T]
GGACATGTATATTAATATTAATCTAGCTTATCATTTTGTTTTACTTTTTAATGGCTATTTAGGTGGGGGGCATGAAAGCAACAATGAGATATTTCTCGAG

Reverse complement sequence

CTCGAGAAATATCTCATTGTTGCTTTCATGCCCCCCACCTAAATAGCCATTAAAAAGTAAAACAAAATGATAAGCTAGATTAATATTAATATACATGTCC[G/A]
TAAATATACATGTTTAAATTTAACTTGTACTTGCAACAAAAATAACGGATATAATAGCGAAAATACGTTAAGTAGTGTTAGTTTAGTTTGTTGTTTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	41.30%	0.06%	0.00%	NA
All Indica	2759	87.00%	12.90%	0.11%	0.00%	NA
All Japonica	1512	4.50%	95.50%	0.00%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	59.00%	40.50%	0.50%	0.00%	NA
Indica II	465	93.50%	6.50%	0.00%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.90%	0.00%	0.00%	NA
Temperate Japonica	767	6.10%	93.90%	0.00%	0.00%	NA
Tropical Japonica	504	3.20%	96.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	37.80%	62.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200761930	C -> T	LOC_Os12g02350.1	upstream_gene_variant ; 1861.0bp to feature; MODIFIER	silent_mutation	Average:30.493; most accessible tissue: Zhenshan97 flower, score: 71.382	N	N	N	N
vg1200761930	C -> T	LOC_Os12g02370.2	downstream_gene_variant ; 4504.0bp to feature; MODIFIER	silent_mutation	Average:30.493; most accessible tissue: Zhenshan97 flower, score: 71.382	N	N	N	N
vg1200761930	C -> T	LOC_Os12g02370.4	downstream_gene_variant ; 4504.0bp to feature; MODIFIER	silent_mutation	Average:30.493; most accessible tissue: Zhenshan97 flower, score: 71.382	N	N	N	N
vg1200761930	C -> T	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:30.493; most accessible tissue: Zhenshan97 flower, score: 71.382	N	N	N	N
vg1200761930	C -> T	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:30.493; most accessible tissue: Zhenshan97 flower, score: 71.382	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200761930	NA	3.03E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	4.41E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	7.80E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	9.33E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	7.49E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	6.09E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	1.69E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	2.11E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	4.45E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	8.93E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	1.67E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	1.52E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	3.04E-14	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	1.32E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	2.15E-14	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	3.71E-19	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	8.32E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	3.33E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	1.06E-21	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	2.81E-22	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	9.56E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	5.57E-16	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761930	NA	4.47E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251