Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200761535:

Variant ID: vg1200761535 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 761535
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACACACATATATCTCTTTATTTTTTAGTGCTATCTAAATACTCCTCCGTTTCAGGTTATATGACGTTTTAACTTTGGTTAAAGTCAAACTACTCTAAGTT[G/A]
AACTAATTCTATAGAAAAGTAATAATATTTACAATACCAGCATAGTTTCATTAAATCTATAATTGAATAATTTTTCATAATATACTTGTCTTGGGTTAAA

Reverse complement sequence

TTTAACCCAAGACAAGTATATTATGAAAAATTATTCAATTATAGATTTAATGAAACTATGCTGGTATTGTAAATATTATTACTTTTCTATAGAATTAGTT[C/T]
AACTTAGAGTAGTTTGACTTTAACCAAAGTTAAAACGTCATATAACCTGAAACGGAGGAGTATTTAGATAGCACTAAAAAATAAAGAGATATATGTGTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	8.70%	0.02%	0.00%	NA
All Indica	2759	85.50%	14.50%	0.00%	0.00%	NA
All Japonica	1512	99.30%	0.60%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	57.60%	42.40%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	95.60%	4.40%	0.00%	0.00%	NA
Indica Intermediate	786	87.80%	12.20%	0.00%	0.00%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200761535	G -> A	LOC_Os12g02350.1	upstream_gene_variant ; 2256.0bp to feature; MODIFIER	silent_mutation	Average:55.596; most accessible tissue: Zhenshan97 flower, score: 92.487	N	N	N	N
vg1200761535	G -> A	LOC_Os12g02370.2	downstream_gene_variant ; 4899.0bp to feature; MODIFIER	silent_mutation	Average:55.596; most accessible tissue: Zhenshan97 flower, score: 92.487	N	N	N	N
vg1200761535	G -> A	LOC_Os12g02370.4	downstream_gene_variant ; 4899.0bp to feature; MODIFIER	silent_mutation	Average:55.596; most accessible tissue: Zhenshan97 flower, score: 92.487	N	N	N	N
vg1200761535	G -> A	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:55.596; most accessible tissue: Zhenshan97 flower, score: 92.487	N	N	N	N
vg1200761535	G -> A	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:55.596; most accessible tissue: Zhenshan97 flower, score: 92.487	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200761535	NA	3.23E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	8.80E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	1.42E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	3.98E-06	mr1318	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	8.94E-08	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	3.09E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	9.25E-08	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	4.16E-07	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	1.37E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	1.16E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200761535	NA	8.55E-06	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251