Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200761417:

Variant ID: vg1200761417 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 761417
Reference Allele: CT	Alternative Allele: C
Primary Allele: CT	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCGTCCCCGGCAAATGCGGCGTCAACGTTGGCTTCCCCATCAGCCTCTCCACCGACTGCAACAAGTATATCATCTCTCTTTATTATGACGTCCCCCCC[CT/C]
CTCTCTCTATATATATACACACATATATCTCTTTATTTTTTAGTGCTATCTAAATACTCCTCCGTTTCAGGTTATATGACGTTTTAACTTTGGTTAAAGT

Reverse complement sequence

ACTTTAACCAAAGTTAAAACGTCATATAACCTGAAACGGAGGAGTATTTAGATAGCACTAAAAAATAAAGAGATATATGTGTGTATATATATAGAGAGAG[AG/G]
GGGGGGGACGTCATAATAAAGAGAGATGATATACTTGTTGCAGTCGGTGGAGAGGCTGATGGGGAAGCCAACGTTGACGCCGCATTTGCCGGGGACGCCG

Allele Frequencies:

Populations	Population Size	Frequency of CT(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	0.10%	7.55%	7.81%	NA
All Indica	2759	75.80%	0.20%	11.96%	12.03%	NA
All Japonica	1512	98.50%	0.00%	0.60%	0.93%	NA
Aus	269	90.30%	0.40%	2.97%	6.32%	NA
Indica I	595	97.50%	0.20%	1.01%	1.34%	NA
Indica II	465	52.70%	0.00%	29.03%	18.28%	NA
Indica III	913	76.10%	0.30%	9.31%	14.24%	NA
Indica Intermediate	786	72.80%	0.10%	13.23%	13.87%	NA
Temperate Japonica	767	98.40%	0.00%	0.52%	1.04%	NA
Tropical Japonica	504	98.20%	0.00%	0.79%	0.99%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	84.40%	0.00%	10.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200761417	CT -> C	LOC_Os12g02350.1	upstream_gene_variant ; 2373.0bp to feature; MODIFIER	silent_mutation	Average:63.178; most accessible tissue: Zhenshan97 flower, score: 94.124	N	N	N	N
vg1200761417	CT -> C	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:63.178; most accessible tissue: Zhenshan97 flower, score: 94.124	N	N	N	N
vg1200761417	CT -> C	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:63.178; most accessible tissue: Zhenshan97 flower, score: 94.124	N	N	N	N
vg1200761417	CT -> DEL	N	N	silent_mutation	Average:63.178; most accessible tissue: Zhenshan97 flower, score: 94.124	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1200761417	CT	C	0.03	-0.03	-0.02	-0.01	-0.02	-0.11