Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200761416:

Variant ID: vg1200761416 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 761416
Reference Allele: CCT	Alternative Allele: CCCCACT,CCCCCACT,CCCACT,TCT,C
Primary Allele: CCT	Secondary Allele: CCCCACT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGCGTCCCCGGCAAATGCGGCGTCAACGTTGGCTTCCCCATCAGCCTCTCCACCGACTGCAACAAGTATATCATCTCTCTTTATTATGACGTCCCCCC[CCT/CCCCACT,CCCCCACT,CCCACT,TCT,C]
CTCTCTCTATATATATACACACATATATCTCTTTATTTTTTAGTGCTATCTAAATACTCCTCCGTTTCAGGTTATATGACGTTTTAACTTTGGTTAAAGT

Reverse complement sequence

ACTTTAACCAAAGTTAAAACGTCATATAACCTGAAACGGAGGAGTATTTAGATAGCACTAAAAAATAAAGAGATATATGTGTGTATATATATAGAGAGAG[AGG/AGTGGGG,AGTGGGGG,AGTGGG,AGA,G]
GGGGGGACGTCATAATAAAGAGAGATGATATACTTGTTGCAGTCGGTGGAGAGGCTGATGGGGAAGCCAACGTTGACGCCGCATTTGCCGGGGACGCCGG

Allele Frequencies:

Populations	Population Size	Frequency of CCT(primary allele)	Frequency of CCCCACT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.10%	1.50%	11.21%	6.77%	CCCCCACT: 0.32%; TCT: 0.06%; C: 0.02%; CCCACT: 0.02%
All Indica	2759	68.80%	2.50%	17.62%	10.44%	CCCCCACT: 0.54%; CCCACT: 0.04%; TCT: 0.04%
All Japonica	1512	98.30%	0.00%	0.73%	0.86%	C: 0.07%
Aus	269	87.40%	0.00%	7.81%	4.83%	NA
Indica I	595	96.50%	0.20%	2.02%	1.34%	NA
Indica II	465	48.00%	0.20%	36.34%	15.48%	NA
Indica III	913	65.40%	5.30%	15.12%	12.81%	CCCCCACT: 1.42%
Indica Intermediate	786	64.20%	2.40%	21.25%	11.58%	CCCCCACT: 0.25%; TCT: 0.13%; CCCACT: 0.13%
Temperate Japonica	767	98.20%	0.00%	0.78%	1.04%	NA
Tropical Japonica	504	98.20%	0.00%	0.79%	0.79%	C: 0.20%
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	96.90%	1.00%	1.04%	1.04%	NA
Intermediate	90	78.90%	1.10%	12.22%	5.56%	TCT: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200761416	CCT -> C	LOC_Os12g02350.1	upstream_gene_variant ; 2374.0bp to feature; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> C	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> C	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCCACT	LOC_Os12g02350.1	upstream_gene_variant ; 2373.0bp to feature; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCCACT	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCCACT	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCCCACT	LOC_Os12g02350.1	upstream_gene_variant ; 2373.0bp to feature; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCCCACT	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCCCACT	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> TCT	LOC_Os12g02350.1	upstream_gene_variant ; 2375.0bp to feature; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> TCT	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> TCT	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> DEL	N	N	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCACT	LOC_Os12g02350.1	upstream_gene_variant ; 2373.0bp to feature; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCACT	LOC_Os12g02340.1	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N
vg1200761416	CCT -> CCCACT	LOC_Os12g02340.2	intron_variant ; MODIFIER	silent_mutation	Average:63.173; most accessible tissue: Zhenshan97 flower, score: 94.071	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1200761416	CCT	C	0.13	0.11	0.08	0.06	0.02	-0.32
vg1200761416	CCT	CCCAC*	-0.05	0.13	0.04	0.05	0.04	-0.19
vg1200761416	CCT	CCCCA*	0.0	0.13	-0.07	0.08	0.04	-0.21
vg1200761416	CCT	CCCCC*	0.05	0.25	0.14	0.14	0.15	-0.23
vg1200761416	CCT	TCT	-0.01	0.01	0.01	0.0	0.0	0.0