Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200639944:

Variant ID: vg1200639944 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 639944
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AACATAAATATCAGTAAACTTAAACATCCGCAGTCAACCTCTGAACATGCATACATCACATTTGGCGATGATATGATGAATTTTCACTTTCAGCAATAGT[A/T]
TGTGTTTCACTTTCAACAGCAATAGCCGTACACATGAGCAAAGTGACAGTCTCAAGACGGCCTTATTCGATACTCTGAATTTACAAGGCACTATGTGCGT

Reverse complement sequence

ACGCACATAGTGCCTTGTAAATTCAGAGTATCGAATAAGGCCGTCTTGAGACTGTCACTTTGCTCATGTGTACGGCTATTGCTGTTGAAAGTGAAACACA[T/A]
ACTATTGCTGAAAGTGAAAATTCATCATATCATCGCCAAATGTGATGTATGCATGTTCAGAGGTTGACTGCGGATGTTTAAGTTTACTGATATTTATGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	5.00%	0.06%	0.00%	NA
All Indica	2759	98.30%	1.70%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	30.10%	69.10%	0.74%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	97.80%	2.10%	0.11%	0.00%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200639944	A -> T	LOC_Os12g02120.1	3_prime_UTR_variant ; 477.0bp to feature; MODIFIER	silent_mutation	Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02	N	N	N	N
vg1200639944	A -> T	LOC_Os12g02120.2	3_prime_UTR_variant ; 477.0bp to feature; MODIFIER	silent_mutation	Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02	N	N	N	N
vg1200639944	A -> T	LOC_Os12g02100.1	downstream_gene_variant ; 1914.0bp to feature; MODIFIER	silent_mutation	Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02	N	N	N	N
vg1200639944	A -> T	LOC_Os12g02105.1	downstream_gene_variant ; 712.0bp to feature; MODIFIER	silent_mutation	Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02	N	N	N	N
vg1200639944	A -> T	LOC_Os12g02100.2	downstream_gene_variant ; 1914.0bp to feature; MODIFIER	silent_mutation	Average:47.48; most accessible tissue: Zhenshan97 flower, score: 66.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200639944	NA	1.28E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	3.42E-16	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	3.86E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	2.05E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	1.63E-06	NA	mr1208	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	5.48E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	3.84E-09	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	1.75E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	2.93E-14	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	2.09E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200639944	NA	5.13E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251