Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200354737:

Variant ID: vg1200354737 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 354737
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.11, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGACTTGAGTGATTTTGTGGTTTTTCAGGTTAGGGAGCAAAGGTGGACCATGGAAAATAATCTGGTCTGAAACTGAGTAAAGAAAAAAGATAGTGATG[C/T]
ATAATTATTAGATTAACATCTTACAGCAAACATGTAAAGGCAACTACACAGGAAAGGCAGATAGCTGCTGGTCATAGTTCAGAATAAGATTTTCTTTGGG

Reverse complement sequence

CCCAAAGAAAATCTTATTCTGAACTATGACCAGCAGCTATCTGCCTTTCCTGTGTAGTTGCCTTTACATGTTTGCTGTAAGATGTTAATCTAATAATTAT[G/A]
CATCACTATCTTTTTTCTTTACTCAGTTTCAGACCAGATTATTTTCCATGGTCCACCTTTGCTCCCTAACCTGAAAAACCACAAAATCACTCAAGTCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 49.80% 0.28% 0.08% NA
All Indica  2759 22.60% 76.90% 0.36% 0.14% NA
All Japonica  1512 95.80% 4.20% 0.07% 0.00% NA
Aus  269 50.20% 49.40% 0.37% 0.00% NA
Indica I  595 37.00% 62.70% 0.17% 0.17% NA
Indica II  465 15.70% 83.40% 0.22% 0.65% NA
Indica III  913 20.50% 79.30% 0.22% 0.00% NA
Indica Intermediate  786 18.30% 80.90% 0.76% 0.00% NA
Temperate Japonica  767 94.10% 5.90% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.60% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200354737 C -> DEL N N silent_mutation Average:74.386; most accessible tissue: Callus, score: 87.414 N N N N
vg1200354737 C -> T LOC_Os12g01580.1 3_prime_UTR_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:74.386; most accessible tissue: Callus, score: 87.414 N N N N
vg1200354737 C -> T LOC_Os12g01580.2 3_prime_UTR_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:74.386; most accessible tissue: Callus, score: 87.414 N N N N
vg1200354737 C -> T LOC_Os12g01574.1 upstream_gene_variant ; 4092.0bp to feature; MODIFIER silent_mutation Average:74.386; most accessible tissue: Callus, score: 87.414 N N N N
vg1200354737 C -> T LOC_Os12g01590.1 downstream_gene_variant ; 786.0bp to feature; MODIFIER silent_mutation Average:74.386; most accessible tissue: Callus, score: 87.414 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1200354737 C T 0.0 0.01 0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200354737 NA 8.54E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251