Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200353430:

Variant ID: vg1200353430 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 353430
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCATGTATTTAGGTATTTGACAGCGTTCATCCTCCTCTGGAAGTTGAATAGCAAAATAGTTCTGTTCTCATGGAATATTGTTTCTGGAGACATCATCC[G/A]
CTACCTAAAATCTGGTTGGTCAATATTCCTCATGTTGATTTCCAAAGACTACAAATGGTGGTCTTGCTTCGTAAGAAAACGTTGATCTAAATGAACAGAT

Reverse complement sequence

ATCTGTTCATTTAGATCAACGTTTTCTTACGAAGCAAGACCACCATTTGTAGTCTTTGGAAATCAACATGAGGAATATTGACCAACCAGATTTTAGGTAG[C/T]
GGATGATGTCTCCAGAAACAATATTCCATGAGAACAGAACTATTTTGCTATTCAACTTCCAGAGGAGGATGAACGCTGTCAAATACCTAAATACATGCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.30%	0.11%	0.15%	NA
All Indica	2759	77.70%	21.90%	0.14%	0.22%	NA
All Japonica	1512	40.70%	59.20%	0.00%	0.07%	NA
Aus	269	50.20%	49.80%	0.00%	0.00%	NA
Indica I	595	63.50%	36.30%	0.00%	0.17%	NA
Indica II	465	83.90%	15.30%	0.00%	0.86%	NA
Indica III	913	79.80%	20.00%	0.00%	0.11%	NA
Indica Intermediate	786	82.40%	17.00%	0.51%	0.00%	NA
Temperate Japonica	767	65.80%	34.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.50%	93.30%	0.00%	0.20%	NA
Japonica Intermediate	241	32.40%	67.60%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200353430	G -> DEL	LOC_Os12g01580.2	N	frameshift_variant	Average:44.876; most accessible tissue: Callus, score: 81.742	N	N	N	N
vg1200353430	G -> DEL	LOC_Os12g01580.1	N	frameshift_variant	Average:44.876; most accessible tissue: Callus, score: 81.742	N	N	N	N
vg1200353430	G -> A	LOC_Os12g01580.1	missense_variant ; p.Arg339His; MODERATE	nonsynonymous_codon ; R339H	Average:44.876; most accessible tissue: Callus, score: 81.742	benign	0.505	DELETERIOUS	0.03
vg1200353430	G -> A	LOC_Os12g01580.2	missense_variant ; p.Arg128His; MODERATE	nonsynonymous_codon ; R128H	Average:44.876; most accessible tissue: Callus, score: 81.742	benign	0.427	TOLERATED	0.09

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200353430	NA	1.18E-13	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200353430	NA	6.56E-16	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200353430	NA	1.25E-16	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200353430	NA	2.58E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	1.21E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	3.49E-07	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	6.31E-07	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	7.25E-06	7.25E-06	mr1074_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	3.55E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	1.24E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	2.73E-06	mr1185_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	1.48E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	4.63E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	3.11E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	1.86E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	2.90E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	8.95E-09	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	5.62E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	3.78E-06	mr1638_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	3.07E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	6.90E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	9.42E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	7.10E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200353430	NA	2.62E-06	mr1912_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251