Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200352164:

Variant ID: vg1200352164 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 352164
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TACTATTACTTCAAAAATGTTTCCAGACCTATTCTATGTGCTTTATTAGTCAAGTTTTCAGCTGATAATAAGGAATCAAAACAACAGTCCTTGATCAATG[T/C]
GTGAATATGAAGCCAAACTAGAATTTACATTAAAATAATAGCATGACACTATAACAATATTTGGACAAAGTTTGTACCGTAAGCATATTACTTATTTATA

Reverse complement sequence

TATAAATAAGTAATATGCTTACGGTACAAACTTTGTCCAAATATTGTTATAGTGTCATGCTATTATTTTAATGTAAATTCTAGTTTGGCTTCATATTCAC[A/G]
CATTGATCAAGGACTGTTGTTTTGATTCCTTATTATCAGCTGAAAACTTGACTAATAAAGCACATAGAATAGGTCTGGAAACATTTTTGAAGTAATAGTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	49.60%	0.28%	0.00%	NA
All Indica	2759	23.00%	76.60%	0.40%	0.00%	NA
All Japonica	1512	95.80%	4.10%	0.07%	0.00%	NA
Aus	269	50.60%	49.40%	0.00%	0.00%	NA
Indica I	595	37.60%	62.40%	0.00%	0.00%	NA
Indica II	465	15.90%	83.40%	0.65%	0.00%	NA
Indica III	913	20.60%	79.00%	0.44%	0.00%	NA
Indica Intermediate	786	19.00%	80.50%	0.51%	0.00%	NA
Temperate Japonica	767	94.30%	5.70%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.60%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200352164	T -> C	LOC_Os12g01574.1	upstream_gene_variant ; 1519.0bp to feature; MODIFIER	silent_mutation	Average:53.469; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1200352164	T -> C	LOC_Os12g01570.1	downstream_gene_variant ; 3019.0bp to feature; MODIFIER	silent_mutation	Average:53.469; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1200352164	T -> C	LOC_Os12g01590.1	downstream_gene_variant ; 3359.0bp to feature; MODIFIER	silent_mutation	Average:53.469; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1200352164	T -> C	LOC_Os12g01580.1	intron_variant ; MODIFIER	silent_mutation	Average:53.469; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1200352164	T -> C	LOC_Os12g01580.2	intron_variant ; MODIFIER	silent_mutation	Average:53.469; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200352164	NA	7.20E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251