\
| Variant ID: vg1128443567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28443567 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGTCTGTTACCTCTCCCTCTTTCTTTTCTTTTTCAAAAGGGTTTAATTAAATCCTTTTTCCTTTAAGACCAAAAACCCAATAATCTTAGAAATTCAATAT[A/C]
TTCTCAACCGTGTGTCCGTTTGACTCCGTTCAACTTCCAAAATTCCTCAAATCTCAAGATCTATCTAATGGCACGCTTAGAGGTCAATAATAGGGCTTTG
CAAAGCCCTATTATTGACCTCTAAGCGTGCCATTAGATAGATCTTGAGATTTGAGGAATTTTGGAAGTTGAACGGAGTCAAACGGACACACGGTTGAGAA[T/G]
ATATTGAATTTCTAAGATTATTGGGTTTTTGGTCTTAAAGGAAAAAGGATTTAATTAAACCCTTTTGAAAAAGAAAAGAAAGAGGGAGAGGTAACAGACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.40% | 10.60% | 0.44% | 41.56% | NA |
| All Indica | 2759 | 42.80% | 13.70% | 0.54% | 42.95% | NA |
| All Japonica | 1512 | 54.40% | 6.50% | 0.33% | 38.76% | NA |
| Aus | 269 | 66.90% | 0.70% | 0.00% | 32.34% | NA |
| Indica I | 595 | 41.20% | 32.30% | 0.50% | 26.05% | NA |
| Indica II | 465 | 26.70% | 1.10% | 1.29% | 70.97% | NA |
| Indica III | 913 | 48.30% | 13.30% | 0.22% | 38.23% | NA |
| Indica Intermediate | 786 | 47.10% | 7.80% | 0.51% | 44.66% | NA |
| Temperate Japonica | 767 | 52.30% | 10.80% | 0.26% | 36.64% | NA |
| Tropical Japonica | 504 | 57.70% | 1.20% | 0.60% | 40.48% | NA |
| Japonica Intermediate | 241 | 53.90% | 4.10% | 0.00% | 41.91% | NA |
| VI/Aromatic | 96 | 17.70% | 8.30% | 0.00% | 73.96% | NA |
| Intermediate | 90 | 47.80% | 12.20% | 1.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128443567 | A -> DEL | N | N | silent_mutation | Average:26.952; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg1128443567 | A -> C | LOC_Os11g47300.1 | upstream_gene_variant ; 804.0bp to feature; MODIFIER | silent_mutation | Average:26.952; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg1128443567 | A -> C | LOC_Os11g47290-LOC_Os11g47300 | intergenic_region ; MODIFIER | silent_mutation | Average:26.952; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128443567 | NA | 1.26E-07 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 2.33E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 4.27E-06 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 3.17E-07 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 2.01E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 5.17E-06 | mr1127_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 1.96E-06 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 4.00E-06 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 8.40E-06 | mr1230_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 5.11E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 2.93E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 1.22E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 5.18E-06 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 1.54E-06 | mr1415_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 3.84E-07 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 3.01E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 5.30E-07 | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 7.75E-06 | mr1787_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 7.38E-06 | mr1820_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 1.68E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128443567 | NA | 9.91E-06 | mr1890_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |