\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128443567:

Variant ID: vg1128443567 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28443567
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCTGTTACCTCTCCCTCTTTCTTTTCTTTTTCAAAAGGGTTTAATTAAATCCTTTTTCCTTTAAGACCAAAAACCCAATAATCTTAGAAATTCAATAT[A/C]
TTCTCAACCGTGTGTCCGTTTGACTCCGTTCAACTTCCAAAATTCCTCAAATCTCAAGATCTATCTAATGGCACGCTTAGAGGTCAATAATAGGGCTTTG

Reverse complement sequence

CAAAGCCCTATTATTGACCTCTAAGCGTGCCATTAGATAGATCTTGAGATTTGAGGAATTTTGGAAGTTGAACGGAGTCAAACGGACACACGGTTGAGAA[T/G]
ATATTGAATTTCTAAGATTATTGGGTTTTTGGTCTTAAAGGAAAAAGGATTTAATTAAACCCTTTTGAAAAAGAAAAGAAAGAGGGAGAGGTAACAGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 10.60% 0.44% 41.56% NA
All Indica  2759 42.80% 13.70% 0.54% 42.95% NA
All Japonica  1512 54.40% 6.50% 0.33% 38.76% NA
Aus  269 66.90% 0.70% 0.00% 32.34% NA
Indica I  595 41.20% 32.30% 0.50% 26.05% NA
Indica II  465 26.70% 1.10% 1.29% 70.97% NA
Indica III  913 48.30% 13.30% 0.22% 38.23% NA
Indica Intermediate  786 47.10% 7.80% 0.51% 44.66% NA
Temperate Japonica  767 52.30% 10.80% 0.26% 36.64% NA
Tropical Japonica  504 57.70% 1.20% 0.60% 40.48% NA
Japonica Intermediate  241 53.90% 4.10% 0.00% 41.91% NA
VI/Aromatic  96 17.70% 8.30% 0.00% 73.96% NA
Intermediate  90 47.80% 12.20% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128443567 A -> DEL N N silent_mutation Average:26.952; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg1128443567 A -> C LOC_Os11g47300.1 upstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:26.952; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg1128443567 A -> C LOC_Os11g47290-LOC_Os11g47300 intergenic_region ; MODIFIER silent_mutation Average:26.952; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128443567 NA 1.26E-07 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 2.33E-06 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 4.27E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 3.17E-07 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 2.01E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 5.17E-06 mr1127_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 1.96E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 4.00E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 8.40E-06 mr1230_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 5.11E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 2.93E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 1.22E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 5.18E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 1.54E-06 mr1415_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 3.84E-07 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 3.01E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 5.30E-07 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 7.75E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 7.38E-06 mr1820_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 1.68E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128443567 NA 9.91E-06 mr1890_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251