Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125876512:

Variant ID: vg1125876512 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25876512
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.43, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

CTATTTTGTTATCTCTACTATTATAAAAATTAAAGATGTTTTTGCCGGTACTTTGGTACGTCATCCGTGTATAAGTCGGTTTTTAAGTTCGTTCGCTTTT[G/A]
CAAATAAATCTCTGTATTTGAATCAGTTTTTAGGTTTGTTCGTTTTTGAAAATACAAAATGAGTCGTATAAGAAATCTCTTTGAAAAAACTCGCATGCTA

Reverse complement sequence

TAGCATGCGAGTTTTTTCAAAGAGATTTCTTATACGACTCATTTTGTATTTTCAAAAACGAACAAACCTAAAAACTGATTCAAATACAGAGATTTATTTG[C/T]
AAAAGCGAACGAACTTAAAAACCGACTTATACACGGATGACGTACCAAAGTACCGGCAAAAACATCTTTAATTTTTATAATAGTAGAGATAACAAAATAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	25.90%	0.99%	35.19%	NA
All Indica	2759	54.50%	17.10%	1.20%	27.11%	NA
All Japonica	1512	11.40%	39.70%	0.46%	48.35%	NA
Aus	269	26.80%	27.90%	1.49%	43.87%	NA
Indica I	595	53.30%	43.00%	0.34%	3.36%	NA
Indica II	465	36.10%	9.90%	1.94%	52.04%	NA
Indica III	913	61.70%	7.10%	1.10%	30.12%	NA
Indica Intermediate	786	58.10%	13.50%	1.53%	26.84%	NA
Temperate Japonica	767	7.40%	61.40%	0.39%	30.77%	NA
Tropical Japonica	504	18.30%	6.30%	0.60%	74.80%	NA
Japonica Intermediate	241	10.00%	40.70%	0.41%	48.96%	NA
VI/Aromatic	96	3.10%	53.10%	1.04%	42.71%	NA
Intermediate	90	45.60%	24.40%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125876512	G -> A	LOC_Os11g42920.1	upstream_gene_variant ; 420.0bp to feature; MODIFIER	silent_mutation	Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268	N	N	N	N
vg1125876512	G -> A	LOC_Os11g42930.1	downstream_gene_variant ; 1255.0bp to feature; MODIFIER	silent_mutation	Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268	N	N	N	N
vg1125876512	G -> A	LOC_Os11g42920-LOC_Os11g42930	intergenic_region ; MODIFIER	silent_mutation	Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268	N	N	N	N
vg1125876512	G -> DEL	N	N	silent_mutation	Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125876512	1.41E-09	5.95E-15	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	7.65E-06	3.59E-09	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	9.67E-13	5.18E-21	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	1.37E-07	3.72E-13	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	3.36E-06	3.36E-06	mr1644	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	6.88E-10	3.95E-22	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	5.98E-08	1.81E-14	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	NA	5.99E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512	NA	9.33E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251