\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125669845:

Variant ID: vg1125669845 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25669845
Reference Allele: ACAlternative Allele: GC,A
Primary Allele: ACSecondary Allele: GC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGCTCAAGCAGACAAACGCATCGGCCGGCCAAGCAACGGAAATCCGTGCATGAAAGGCTGGGGCCGATGCACCAAGATCAACACGATGAAGATGAGGA[AC/GC,A]
AAGTCCAGAACCCCCAATGGTGCCCAAGCGATGTATTCAGCAAGACACAGAAGCGGCGGGTTCAGAGGTTAAGGAGGAAAGAGCAAATCCAAGAGCAACA

Reverse complement sequence

TGTTGCTCTTGGATTTGCTCTTTCCTCCTTAACCTCTGAACCCGCCGCTTCTGTGTCTTGCTGAATACATCGCTTGGGCACCATTGGGGGTTCTGGACTT[GT/GC,T]
TCCTCATCTTCATCGTGTTGATCTTGGTGCATCGGCCCCAGCCTTTCATGCACGGATTTCCGTTGCTTGGCCGGCCGATGCGTTTGTCTGCTTGAGCTGC

Allele Frequencies:

Populations Population SizeFrequency of AC(primary allele) Frequency of GC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 16.50% 5.92% 12.00% A: 2.26%
All Indica  2759 54.80% 24.80% 6.49% 13.85% A: 0.11%
All Japonica  1512 75.50% 4.80% 5.09% 7.80% A: 6.81%
Aus  269 70.60% 2.20% 6.69% 20.45% NA
Indica I  595 55.30% 33.10% 2.69% 8.91% NA
Indica II  465 42.60% 29.70% 6.45% 21.29% NA
Indica III  913 59.30% 18.80% 8.87% 12.81% A: 0.22%
Indica Intermediate  786 56.50% 22.40% 6.62% 14.38% A: 0.13%
Temperate Japonica  767 85.00% 2.20% 3.78% 6.00% A: 3.00%
Tropical Japonica  504 71.00% 5.00% 5.36% 10.32% A: 8.33%
Japonica Intermediate  241 54.80% 12.40% 8.71% 8.30% A: 15.77%
VI/Aromatic  96 91.70% 3.10% 2.08% 3.12% NA
Intermediate  90 64.40% 20.00% 4.44% 10.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125669845 AC -> GC LOC_Os11g42630.1 synonymous_variant ; p.Glu740Glu; LOW synonymous_codon Average:68.996; most accessible tissue: Minghui63 flag leaf, score: 95.448 N N N N
vg1125669845 AC -> A LOC_Os11g42630.1 frameshift_variant ; p.Gln741fs; HIGH frameshift_variant Average:68.996; most accessible tissue: Minghui63 flag leaf, score: 95.448 N N N N
vg1125669845 AC -> DEL LOC_Os11g42630.1 N frameshift_variant Average:68.996; most accessible tissue: Minghui63 flag leaf, score: 95.448 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125669845 AC A 0.02 0.02 0.0 0.04 0.02 0.02
vg1125669845 AC GC 0.01 0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125669845 8.55E-12 1.11E-22 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 6.12E-13 7.44E-20 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 7.06E-17 1.05E-26 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 1.18E-16 4.11E-23 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 NA 1.52E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 5.08E-11 2.26E-32 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 1.00E-13 1.31E-27 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 NA 1.22E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669845 NA 1.53E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251