Variant ID: vg1124756478 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 24756478 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGACCAGGAGTTCTCGAGCTCGATATCCTTCGCTCTCGTCCGGACCGCCGGCGCCGGCGACAATGTCCGTCTCCATGCGAGAGCCAAGATCAGCTTGCTC[G/A]
ACCTCGCCGGCGAGCCGGTGGCACGGTACAGCCAACCCGTCGACAAGTGTTCCACCTCCAAGGCAAGCGATCCATGGGTTTGCAAGAGCTTCATCGAGAG
CTCTCGATGAAGCTCTTGCAAACCCATGGATCGCTTGCCTTGGAGGTGGAACACTTGTCGACGGGTTGGCTGTACCGTGCCACCGGCTCGCCGGCGAGGT[C/T]
GAGCAAGCTGATCTTGGCTCTCGCATGGAGACGGACATTGTCGCCGGCGCCGGCGGTCCGGACGAGAGCGAAGGATATCGAGCTCGAGAACTCCTGGTCG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1124756478 | G -> A | LOC_Os11g41300.1 | missense_variant ; p.Asp105Asn; MODERATE | nonsynonymous_codon ; D105N | Average:76.193; most accessible tissue: Minghui63 flag leaf, score: 85.151 | unknown | unknown | TOLERATED | 0.07 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1124756478 | 5.64E-06 | 3.70E-07 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124756478 | NA | 6.68E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124756478 | 4.81E-08 | 7.40E-10 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124756478 | 2.07E-07 | 2.07E-07 | mr1484_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124756478 | NA | 2.64E-07 | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124756478 | NA | 4.96E-07 | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124756478 | 4.88E-09 | 4.88E-09 | mr1945_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |