\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122207231:

Variant ID: vg1122207231 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22207231
Reference Allele: GAlternative Allele: A,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGGTCCATGGAATTGTTATTATGTACACATATATATGGTCTCCTGTGCTATAAAACCAGGGGCCAACACTGCCCCCACCGCTGCCCGTCAGCTCTGGC[G/A,C]
CCCCCTTGTGAGTACCCCCCCCTTTGATGTCGCGGCGACGATGGCTAGTGTCGATGGTGTCTTTTTCTTGCCTTGCTCTGATTCCTTGGTTTCTTGGTGG

Reverse complement sequence

CCACCAAGAAACCAAGGAATCAGAGCAAGGCAAGAAAAAGACACCATCGACACTAGCCATCGTCGCCGCGACATCAAAGGGGGGGGTACTCACAAGGGGG[C/T,G]
GCCAGAGCTGACGGGCAGCGGTGGGGGCAGTGTTGGCCCCTGGTTTTATAGCACAGGAGACCATATATATGTGTACATAATAACAATTCCATGGACCGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 29.40% 0.36% 19.21% C: 0.06%
All Indica  2759 59.90% 17.00% 0.33% 22.76% C: 0.04%
All Japonica  1512 36.00% 57.80% 0.20% 5.89% C: 0.07%
Aus  269 58.00% 5.90% 1.12% 34.94% NA
Indica I  595 42.20% 35.10% 0.84% 21.85% NA
Indica II  465 67.50% 2.60% 0.00% 29.89% NA
Indica III  913 63.70% 16.80% 0.11% 19.28% C: 0.11%
Indica Intermediate  786 64.20% 12.10% 0.38% 23.28% NA
Temperate Japonica  767 30.20% 66.50% 0.00% 3.26% NA
Tropical Japonica  504 46.60% 45.80% 0.40% 6.94% C: 0.20%
Japonica Intermediate  241 32.40% 55.20% 0.41% 12.03% NA
VI/Aromatic  96 14.60% 6.20% 0.00% 79.17% NA
Intermediate  90 47.80% 25.60% 2.22% 23.33% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122207231 G -> A LOC_Os11g37610.1 upstream_gene_variant ; 4585.0bp to feature; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> A LOC_Os11g37620.1 upstream_gene_variant ; 2555.0bp to feature; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> A LOC_Os11g37630.1 downstream_gene_variant ; 1048.0bp to feature; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> A LOC_Os11g37620-LOC_Os11g37630 intergenic_region ; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> DEL N N silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> C LOC_Os11g37610.1 upstream_gene_variant ; 4585.0bp to feature; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> C LOC_Os11g37620.1 upstream_gene_variant ; 2555.0bp to feature; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> C LOC_Os11g37630.1 downstream_gene_variant ; 1048.0bp to feature; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1122207231 G -> C LOC_Os11g37620-LOC_Os11g37630 intergenic_region ; MODIFIER silent_mutation Average:51.224; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122207231 NA 8.62E-06 mr1567_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251