Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1121970827:

Variant ID: vg1121970827 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21970827
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCACATGGATGCACGGAGTACTAAAATGTCAGGACGATGTTATCCTGAAACTTCAGGCTACATAACCCCATGATACTAGGAGTACAGTGCCTACTACCC[G/T]
TACTTCAGCATCGATCATGCATAGAACTCTCTCATATTCAGATTCATTATATTAGAATGTGTCACATCTAATAAAAAAATTTATATTTAGTTGTGGAGAA

Reverse complement sequence

TTCTCCACAACTAAATATAAATTTTTTTATTAGATGTGACACATTCTAATATAATGAATCTGAATATGAGAGAGTTCTATGCATGATCGATGCTGAAGTA[C/A]
GGGTAGTAGGCACTGTACTCCTAGTATCATGGGGTTATGTAGCCTGAAGTTTCAGGATAACATCGTCCTGACATTTTAGTACTCCGTGCATCCATGTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 2.00% 0.53% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 92.30% 6.20% 1.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 85.40% 11.70% 2.87% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121970827 G -> T LOC_Os11g37190.1 downstream_gene_variant ; 1624.0bp to feature; MODIFIER silent_mutation Average:63.209; most accessible tissue: Minghui63 panicle, score: 98.736 N N N N
vg1121970827 G -> T LOC_Os11g37190-LOC_Os11g37200 intergenic_region ; MODIFIER silent_mutation Average:63.209; most accessible tissue: Minghui63 panicle, score: 98.736 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121970827 G T 0.09 0.0 -0.01 -0.02 -0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121970827 6.76E-07 6.76E-07 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 3.45E-09 7.84E-15 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 3.28E-07 4.30E-13 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 NA 4.03E-07 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 9.48E-09 9.48E-09 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 NA 1.40E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 6.05E-07 1.82E-06 mr1559 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 5.70E-10 6.19E-18 mr1585 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 7.99E-09 1.01E-14 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 4.24E-06 4.24E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 NA 3.47E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 3.76E-06 3.76E-06 mr1803 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 5.26E-10 1.06E-14 mr1305_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 4.66E-07 3.13E-09 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 2.96E-06 1.45E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 2.25E-07 2.92E-16 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 NA 2.52E-07 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 4.89E-06 3.10E-09 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121970827 NA 3.56E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251