Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1119960918:

Variant ID: vg1119960918 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19960918
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGTTGAGAGCATATATATATTTAGAGGTACCTGTCTATCTTTAGTTAAAATAACGTAAGATATCATAATAAAGGTTTGACAAACTTCACCAAGTTGGG[A/C]
AAGTTCAGCTTTATGGCTTACATATACTTGGTTCTTTAACCCAAGAGAAATCAATAGAATATATACACATGTACATATGCATGTTAATCTATTAGGTGTA

Reverse complement sequence

TACACCTAATAGATTAACATGCATATGTACATGTGTATATATTCTATTGATTTCTCTTGGGTTAAAGAACCAAGTATATGTAAGCCATAAAGCTGAACTT[T/G]
CCCAACTTGGTGAAGTTTGTCAAACCTTTATTATGATATCTTACGTTATTTTAACTAAAGATAGACAGGTACCTCTAAATATATATATGCTCTCAACATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.10% 0.02% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 26.00% 1.04% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119960918 A -> C LOC_Os11g34110.1 intron_variant ; MODIFIER silent_mutation Average:40.633; most accessible tissue: Minghui63 root, score: 68.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119960918 NA 5.06E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119960918 6.96E-11 1.26E-46 mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119960918 8.89E-12 3.17E-54 mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119960918 3.13E-10 2.71E-49 mr1757 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119960918 NA 1.72E-06 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119960918 NA 1.79E-34 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119960918 1.71E-06 1.53E-50 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119960918 NA 8.65E-34 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251