\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118460774:

Variant ID: vg1118460774 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18460774
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCGTCTTATTAAAAAATATTAGAATTATTATTTATTTTATTTGTGACTTACTTTATTATCCAAAGTAACTTAATCATAACTTTTCTTTTTTATATTTA[C/T]
ATAAATTTTTTTGGATAAGACGAGTAGTCAAACAGTGTAATCAACATATTTTTATCGCTAGTATACCGTTACGGTTTACAATTAATTTTCGGGCGACGCA

Reverse complement sequence

TGCGTCGCCCGAAAATTAATTGTAAACCGTAACGGTATACTAGCGATAAAAATATGTTGATTACACTGTTTGACTACTCGTCTTATCCAAAAAAATTTAT[G/A]
TAAATATAAAAAAGAAAAGTTATGATTAAGTTACTTTGGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTCTAATATTTTTTAATAAGACGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 44.30% 3.81% 0.42% NA
All Indica  2759 41.20% 57.00% 1.74% 0.04% NA
All Japonica  1512 70.30% 20.00% 8.47% 1.19% NA
Aus  269 31.20% 68.00% 0.37% 0.37% NA
Indica I  595 28.40% 69.10% 2.52% 0.00% NA
Indica II  465 61.50% 38.30% 0.22% 0.00% NA
Indica III  913 38.40% 60.20% 1.20% 0.11% NA
Indica Intermediate  786 42.10% 55.20% 2.67% 0.00% NA
Temperate Japonica  767 49.40% 32.90% 15.38% 2.35% NA
Tropical Japonica  504 96.40% 3.00% 0.60% 0.00% NA
Japonica Intermediate  241 82.20% 14.90% 2.90% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 63.30% 33.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118460774 C -> T LOC_Os11g31590.1 downstream_gene_variant ; 3446.0bp to feature; MODIFIER silent_mutation Average:77.396; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N
vg1118460774 C -> T LOC_Os11g31570-LOC_Os11g31590 intergenic_region ; MODIFIER silent_mutation Average:77.396; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N
vg1118460774 C -> DEL N N silent_mutation Average:77.396; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118460774 C T 0.03 0.02 0.0 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118460774 NA 9.32E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 1.55E-07 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 1.26E-06 2.79E-08 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 2.03E-06 5.19E-08 mr1031 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 1.56E-06 6.42E-08 mr1034 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 9.99E-06 2.79E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 9.63E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 5.42E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 6.87E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 2.46E-07 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 1.45E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 1.02E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 3.47E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118460774 NA 2.83E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251