| Variant ID: vg1118143847 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18143847 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 101. )
CTTAAACCGTGCACTCAAGTGGTTTCGCTGAAGTGGCATCCTAGTCAGCAAAAAAAAAATTAAAAAAGTATTTGGGACATGGAGCTCAAGCTCACCTCCG[C/T]
AGCCGACTCGGCCTCCACCGGTCCTTTTCTCCCACTGCCGCCGTCGCGCCGGCCACCTCCTCTCCCGCCGCTGCCATCACGCCGGCCGCCTCCTCTCCTT
AAGGAGAGGAGGCGGCCGGCGTGATGGCAGCGGCGGGAGAGGAGGTGGCCGGCGCGACGGCGGCAGTGGGAGAAAAGGACCGGTGGAGGCCGAGTCGGCT[G/A]
CGGAGGTGAGCTTGAGCTCCATGTCCCAAATACTTTTTTAATTTTTTTTTTGCTGACTAGGATGCCACTTCAGCGAAACCACTTGAGTGCACGGTTTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 36.30% | 0.30% | 6.75% | NA |
| All Indica | 2759 | 58.40% | 39.80% | 0.47% | 1.27% | NA |
| All Japonica | 1512 | 58.10% | 23.80% | 0.07% | 17.99% | NA |
| Aus | 269 | 18.60% | 80.30% | 0.00% | 1.12% | NA |
| Indica I | 595 | 54.50% | 45.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 81.10% | 15.90% | 0.86% | 2.15% | NA |
| Indica III | 913 | 50.80% | 47.00% | 0.22% | 1.97% | NA |
| Indica Intermediate | 786 | 56.90% | 41.70% | 0.51% | 0.89% | NA |
| Temperate Japonica | 767 | 94.50% | 2.90% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 10.10% | 41.10% | 0.20% | 48.61% | NA |
| Japonica Intermediate | 241 | 42.70% | 54.40% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 77.10% | 21.90% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 68.90% | 22.20% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118143847 | C -> T | LOC_Os11g31160.1 | upstream_gene_variant ; 306.0bp to feature; MODIFIER | silent_mutation | Average:64.507; most accessible tissue: Zhenshan97 young leaf, score: 85.364 | N | N | N | N |
| vg1118143847 | C -> T | LOC_Os11g31150-LOC_Os11g31160 | intergenic_region ; MODIFIER | silent_mutation | Average:64.507; most accessible tissue: Zhenshan97 young leaf, score: 85.364 | N | N | N | N |
| vg1118143847 | C -> DEL | N | N | silent_mutation | Average:64.507; most accessible tissue: Zhenshan97 young leaf, score: 85.364 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118143847 | NA | 9.47E-06 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 2.50E-09 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 1.98E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 4.14E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 4.31E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 1.17E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 2.68E-08 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 8.84E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 4.94E-06 | mr1479_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118143847 | NA | 3.15E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/