\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117996451:

Variant ID: vg1117996451 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17996451
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGTCTCCGTCGTCACCGCCAGAATCTCTTGCCTAAGCCTCCCCCACCGCCAGAAACCCCAGAACCCAACCCTCCGCCACCATCATCGCTGCCGCCGCC[A/G]
CCATAACCCAACCATAGATCGCTGTCATCGCCGCGGCCACAACCCAGCTCTCCATTGCCCCTCCTAGGCTTGCTGCCGCCAAAGCCCCTAGGGCCTCCTC

Reverse complement sequence

GAGGAGGCCCTAGGGGCTTTGGCGGCAGCAAGCCTAGGAGGGGCAATGGAGAGCTGGGTTGTGGCCGCGGCGATGACAGCGATCTATGGTTGGGTTATGG[T/C]
GGCGGCGGCAGCGATGATGGTGGCGGAGGGTTGGGTTCTGGGGTTTCTGGCGGTGGGGGAGGCTTAGGCAAGAGATTCTGGCGGTGACGACGGAGACAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 16.30% 0.91% 53.55% NA
All Indica  2759 8.20% 13.30% 1.16% 77.31% NA
All Japonica  1512 68.40% 24.90% 0.13% 6.55% NA
Aus  269 15.20% 1.50% 0.74% 82.53% NA
Indica I  595 18.70% 12.60% 1.18% 67.56% NA
Indica II  465 1.70% 23.20% 1.51% 73.55% NA
Indica III  913 4.60% 10.60% 0.33% 84.45% NA
Indica Intermediate  786 8.30% 11.20% 1.91% 78.63% NA
Temperate Japonica  767 92.40% 4.00% 0.00% 3.52% NA
Tropical Japonica  504 46.00% 42.50% 0.20% 11.31% NA
Japonica Intermediate  241 38.60% 54.80% 0.41% 6.22% NA
VI/Aromatic  96 59.40% 2.10% 4.17% 34.38% NA
Intermediate  90 25.60% 22.20% 3.33% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117996451 A -> DEL LOC_Os11g30930.1 N frameshift_variant Average:13.934; most accessible tissue: Callus, score: 50.662 N N N N
vg1117996451 A -> G LOC_Os11g30930.1 synonymous_variant ; p.Gly78Gly; LOW synonymous_codon Average:13.934; most accessible tissue: Callus, score: 50.662 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117996451 NA 2.04E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 3.67E-06 4.47E-06 mr1157 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 5.88E-06 3.51E-09 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 1.03E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 4.75E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 1.69E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 1.55E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 2.95E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 6.01E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 5.20E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996451 NA 6.33E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251