\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117195800:

Variant ID: vg1117195800 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17195800
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAACTTAGAGACCAATGTTAAAAAAAAACTACAAAATATCTCCAAATCAGTTCTACAATTAAGTTTTAAAATTCAAATTTTAGCATTAGCTTATTCTT[G/A]
TTAGGGCAACCGATGAAGCTGATTATTTTTATGTAAGAAGTGAAACCATCTATAAATTCGTGGATTCTTCATTGCTATGAACCATTGACTTATTTTCAGT

Reverse complement sequence

ACTGAAAATAAGTCAATGGTTCATAGCAATGAAGAATCCACGAATTTATAGATGGTTTCACTTCTTACATAAAAATAATCAGCTTCATCGGTTGCCCTAA[C/T]
AAGAATAAGCTAATGCTAAAATTTGAATTTTAAAACTTAATTGTAGAACTGATTTGGAGATATTTTGTAGTTTTTTTTTAACATTGGTCTCTAAGTTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.80% 0.06% 0.00% NA
All Indica  2759 82.30% 17.60% 0.11% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 95.50% 4.50% 0.00% 0.00% NA
Indica II  465 81.30% 18.70% 0.00% 0.00% NA
Indica III  913 73.10% 26.60% 0.33% 0.00% NA
Indica Intermediate  786 83.60% 16.40% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117195800 G -> A LOC_Os11g29660.1 upstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:46.112; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg1117195800 G -> A LOC_Os11g29670.1 downstream_gene_variant ; 4409.0bp to feature; MODIFIER silent_mutation Average:46.112; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg1117195800 G -> A LOC_Os11g29660-LOC_Os11g29670 intergenic_region ; MODIFIER silent_mutation Average:46.112; most accessible tissue: Minghui63 root, score: 81.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117195800 NA 3.79E-09 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117195800 NA 1.31E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117195800 NA 4.96E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117195800 NA 6.80E-08 mr1567_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117195800 NA 3.30E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251