\
| Variant ID: vg1117195800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17195800 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )
AGCAACTTAGAGACCAATGTTAAAAAAAAACTACAAAATATCTCCAAATCAGTTCTACAATTAAGTTTTAAAATTCAAATTTTAGCATTAGCTTATTCTT[G/A]
TTAGGGCAACCGATGAAGCTGATTATTTTTATGTAAGAAGTGAAACCATCTATAAATTCGTGGATTCTTCATTGCTATGAACCATTGACTTATTTTCAGT
ACTGAAAATAAGTCAATGGTTCATAGCAATGAAGAATCCACGAATTTATAGATGGTTTCACTTCTTACATAAAAATAATCAGCTTCATCGGTTGCCCTAA[C/T]
AAGAATAAGCTAATGCTAAAATTTGAATTTTAAAACTTAATTGTAGAACTGATTTGGAGATATTTTGTAGTTTTTTTTTAACATTGGTCTCTAAGTTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.20% | 11.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 82.30% | 17.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.10% | 26.60% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117195800 | G -> A | LOC_Os11g29660.1 | upstream_gene_variant ; 1785.0bp to feature; MODIFIER | silent_mutation | Average:46.112; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| vg1117195800 | G -> A | LOC_Os11g29670.1 | downstream_gene_variant ; 4409.0bp to feature; MODIFIER | silent_mutation | Average:46.112; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| vg1117195800 | G -> A | LOC_Os11g29660-LOC_Os11g29670 | intergenic_region ; MODIFIER | silent_mutation | Average:46.112; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117195800 | NA | 3.79E-09 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117195800 | NA | 1.31E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117195800 | NA | 4.96E-06 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117195800 | NA | 6.80E-08 | mr1567_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117195800 | NA | 3.30E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |