\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116933718:

Variant ID: vg1116933718 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 16933718
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAATTTTCATTCACTTACTAACACATTGGGTTGATATATATATACTTTTAAGAAATCCATTATATGCCATTGATGAAGCCCCTTATCTATGTAGTAT[A/G]
CCATCAACAAAGCCTCATTATTCGTGTGTAGTGACTTTCAAAAGTTATTTCCTATATTGGGCTACTGGAATTGAGATAAATCTAAGATTTGAGCTAAGCA

Reverse complement sequence

TGCTTAGCTCAAATCTTAGATTTATCTCAATTCCAGTAGCCCAATATAGGAAATAACTTTTGAAAGTCACTACACACGAATAATGAGGCTTTGTTGATGG[T/C]
ATACTACATAGATAAGGGGCTTCATCAATGGCATATAATGGATTTCTTAAAAGTATATATATATCAACCCAATGTGTTAGTAAGTGAATGAAAATTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 39.90% 0.13% 0.00% NA
All Indica  2759 89.10% 10.70% 0.18% 0.00% NA
All Japonica  1512 7.40% 92.60% 0.00% 0.00% NA
Aus  269 76.20% 23.40% 0.37% 0.00% NA
Indica I  595 87.20% 12.60% 0.17% 0.00% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 91.30% 8.50% 0.11% 0.00% NA
Indica Intermediate  786 86.50% 13.20% 0.25% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1116933718 A -> G LOC_Os11g29210.1 downstream_gene_variant ; 3790.0bp to feature; MODIFIER silent_mutation Average:42.501; most accessible tissue: Callus, score: 70.938 N N N N
vg1116933718 A -> G LOC_Os11g29210.2 downstream_gene_variant ; 3774.0bp to feature; MODIFIER silent_mutation Average:42.501; most accessible tissue: Callus, score: 70.938 N N N N
vg1116933718 A -> G LOC_Os11g29200.1 intron_variant ; MODIFIER silent_mutation Average:42.501; most accessible tissue: Callus, score: 70.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1116933718 NA 4.40E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 7.86E-07 7.86E-07 mr1572 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 NA 4.83E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 4.65E-06 NA mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 NA 4.33E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 6.91E-06 7.93E-10 mr1376_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 4.89E-06 3.34E-06 mr1376_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 6.87E-06 3.49E-10 mr1431_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 4.25E-06 2.24E-06 mr1431_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 3.43E-06 NA mr1611_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 2.10E-06 1.08E-06 mr1611_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 NA 2.61E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 NA 1.30E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 3.17E-06 NA mr1924_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 1.80E-06 4.37E-07 mr1924_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 3.53E-06 NA mr1938_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718 NA 9.78E-06 mr1960_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251