Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116933718:

Variant ID: vg1116933718 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16933718
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAAATTTTCATTCACTTACTAACACATTGGGTTGATATATATATACTTTTAAGAAATCCATTATATGCCATTGATGAAGCCCCTTATCTATGTAGTAT[A/G]
CCATCAACAAAGCCTCATTATTCGTGTGTAGTGACTTTCAAAAGTTATTTCCTATATTGGGCTACTGGAATTGAGATAAATCTAAGATTTGAGCTAAGCA

Reverse complement sequence

TGCTTAGCTCAAATCTTAGATTTATCTCAATTCCAGTAGCCCAATATAGGAAATAACTTTTGAAAGTCACTACACACGAATAATGAGGCTTTGTTGATGG[T/C]
ATACTACATAGATAAGGGGCTTCATCAATGGCATATAATGGATTTCTTAAAAGTATATATATATCAACCCAATGTGTTAGTAAGTGAATGAAAATTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	39.90%	0.13%	0.00%	NA
All Indica	2759	89.10%	10.70%	0.18%	0.00%	NA
All Japonica	1512	7.40%	92.60%	0.00%	0.00%	NA
Aus	269	76.20%	23.40%	0.37%	0.00%	NA
Indica I	595	87.20%	12.60%	0.17%	0.00%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	91.30%	8.50%	0.11%	0.00%	NA
Indica Intermediate	786	86.50%	13.20%	0.25%	0.00%	NA
Temperate Japonica	767	3.50%	96.50%	0.00%	0.00%	NA
Tropical Japonica	504	11.50%	88.50%	0.00%	0.00%	NA
Japonica Intermediate	241	11.20%	88.80%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116933718	A -> G	LOC_Os11g29210.1	downstream_gene_variant ; 3790.0bp to feature; MODIFIER	silent_mutation	Average:42.501; most accessible tissue: Callus, score: 70.938	N	N	N	N
vg1116933718	A -> G	LOC_Os11g29210.2	downstream_gene_variant ; 3774.0bp to feature; MODIFIER	silent_mutation	Average:42.501; most accessible tissue: Callus, score: 70.938	N	N	N	N
vg1116933718	A -> G	LOC_Os11g29200.1	intron_variant ; MODIFIER	silent_mutation	Average:42.501; most accessible tissue: Callus, score: 70.938	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116933718	NA	4.40E-07	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	7.86E-07	7.86E-07	mr1572	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	NA	4.83E-06	mr1209_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	4.65E-06	NA	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	NA	4.33E-06	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	6.91E-06	7.93E-10	mr1376_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	4.89E-06	3.34E-06	mr1376_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	6.87E-06	3.49E-10	mr1431_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	4.25E-06	2.24E-06	mr1431_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	3.43E-06	NA	mr1611_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	2.10E-06	1.08E-06	mr1611_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	NA	2.61E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	NA	1.30E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	3.17E-06	NA	mr1924_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	1.80E-06	4.37E-07	mr1924_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	3.53E-06	NA	mr1938_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116933718	NA	9.78E-06	mr1960_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251