Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116062677:

Variant ID: vg1116062677 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16062677
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAAGTGGTTGCTTCGGCGTGCGGGGTATTTTTGGCCGACAATGCTGGAGGATTGTTTTAGATATTACAAAGGATGTCAGGATTGCCAAAAATTTGGAG[C/T]
AATATAAAGGGCACCAGCATCGGCTATGAATCCTATCATTAAGCCATGGCCGTTTAGAGGTTGGGGGATTGATATGACTGGTATGGTAAATCCGCCATCG

Reverse complement sequence

CGATGGCGGATTTACCATACCAGTCATATCAATCCCCCAACCTCTAAACGGCCATGGCTTAATGATAGGATTCATAGCCGATGCTGGTGCCCTTTATATT[G/A]
CTCCAAATTTTTGGCAATCCTGACATCCTTTGTAATATCTAAAACAATCCTCCAGCATTGTCGGCCAAAAATACCCCGCACGCCGAAGCAACCACTTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	9.00%	0.34%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	71.60%	27.40%	0.99%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.20%	0.26%	0.00%	NA
Tropical Japonica	504	29.40%	68.80%	1.79%	0.00%	NA
Japonica Intermediate	241	73.90%	24.50%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116062677	C -> T	LOC_Os11g27900.1	upstream_gene_variant ; 3615.0bp to feature; MODIFIER	silent_mutation	Average:43.562; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg1116062677	C -> T	LOC_Os11g27920.1	downstream_gene_variant ; 1673.0bp to feature; MODIFIER	silent_mutation	Average:43.562; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg1116062677	C -> T	LOC_Os11g27910.1	intron_variant ; MODIFIER	silent_mutation	Average:43.562; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116062677	NA	2.90E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	6.39E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	3.30E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	1.56E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	1.91E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	4.39E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	6.61E-10	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	1.04E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	2.01E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	1.23E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	1.02E-07	1.90E-11	mr1742	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	1.16E-09	mr1742	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	1.61E-11	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	2.00E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	1.72E-06	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	5.72E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	7.64E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	9.32E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116062677	NA	2.58E-15	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251