\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115697103:

Variant ID: vg1115697103 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 15697103
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATATGAGGTGTACATATATACAAGGAGCTAATTAAAGGAATGTAAGAAATATAACTCAACGATACCTAGAAAATCCATGCGCTCAGAATAGAGACGTC[G/A]
AGGGCGTCCAGCTGGTATAGTTTGTAGATATCCTTGAAATTGATCCAGAGAACATCTTCCCCTTGTAAGAAGTCAGTGTTCTTGATCCTCGCTCCGATAA

Reverse complement sequence

TTATCGGAGCGAGGATCAAGAACACTGACTTCTTACAAGGGGAAGATGTTCTCTGGATCAATTTCAAGGATATCTACAAACTATACCAGCTGGACGCCCT[C/T]
GACGTCTCTATTCTGAGCGCATGGATTTTCTAGGTATCGTTGAGTTATATTTCTTACATTCCTTTAATTAGCTCCTTGTATATATGTACACCTCATATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 3.80% 0.28% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 93.10% 6.20% 0.79% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.50% 4.50% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 1.80% 0.26% 0.00% NA
Tropical Japonica  504 83.10% 15.10% 1.79% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1115697103 G -> A LOC_Os11g27290.1 synonymous_variant ; p.Leu381Leu; LOW synonymous_codon Average:34.215; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1115697103 NA 1.41E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 2.29E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 1.45E-09 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 2.86E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 2.52E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 7.92E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 1.91E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 4.97E-09 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 3.68E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 9.87E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 1.08E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 6.84E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 9.16E-08 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 1.05E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 1.35E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 1.66E-09 mr1557_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 9.22E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 8.75E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 2.54E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115697103 NA 8.09E-08 mr1944_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251