\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114869505:

Variant ID: vg1114869505 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14869505
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.07, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGAATACTCTCGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGACGAACTCTGTAACCATAATATACCAGAAGTATTTCTGCGTTATTGCT[G/A]
GGAATTATATTTCTAGTAATGTCGTCAAGAAATACCAACAAGCATTTCTGGCGCCGTTGCCGGGGAAGATTCATAATAGACATTACTTGAACTAATACTT

Reverse complement sequence

AAGTATTAGTTCAAGTAATGTCTATTATGAATCTTCCCCGGCAACGGCGCCAGAAATGCTTGTTGGTATTTCTTGACGACATTACTAGAAATATAATTCC[C/T]
AGCAATAACGCAGAAATACTTCTGGTATATTATGGTTACAGAGTTCGTCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCGAGAGTATTCCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.40% 8.00% 36.27% 26.32% NA
All Indica  2759 4.90% 1.30% 53.39% 40.45% NA
All Japonica  1512 74.90% 22.20% 1.59% 1.39% NA
Aus  269 1.10% 0.00% 65.80% 33.09% NA
Indica I  595 4.70% 1.30% 33.61% 60.34% NA
Indica II  465 6.70% 0.00% 55.70% 37.63% NA
Indica III  913 3.00% 0.00% 69.55% 27.49% NA
Indica Intermediate  786 6.10% 3.60% 48.22% 42.11% NA
Temperate Japonica  767 61.30% 35.70% 1.17% 1.83% NA
Tropical Japonica  504 95.80% 0.80% 2.18% 1.19% NA
Japonica Intermediate  241 74.30% 23.70% 1.66% 0.41% NA
VI/Aromatic  96 84.40% 6.20% 6.25% 3.12% NA
Intermediate  90 43.30% 2.20% 37.78% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114869505 G -> A LOC_Os11g26000.1 upstream_gene_variant ; 323.0bp to feature; MODIFIER silent_mutation Average:10.559; most accessible tissue: Callus, score: 30.184 N N N N
vg1114869505 G -> A LOC_Os11g25990-LOC_Os11g26000 intergenic_region ; MODIFIER silent_mutation Average:10.559; most accessible tissue: Callus, score: 30.184 N N N N
vg1114869505 G -> DEL N N silent_mutation Average:10.559; most accessible tissue: Callus, score: 30.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114869505 7.89E-06 1.55E-07 mr1028 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505 NA 1.55E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505 NA 4.00E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505 NA 3.05E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505 9.77E-06 9.76E-06 mr1424 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505 NA 3.69E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869505 NA 4.25E-07 mr1453 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251