\
| Variant ID: vg1114869505 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14869505 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.07, others allele: 0.00, population size: 113. )
CTTGGAATACTCTCGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGACGAACTCTGTAACCATAATATACCAGAAGTATTTCTGCGTTATTGCT[G/A]
GGAATTATATTTCTAGTAATGTCGTCAAGAAATACCAACAAGCATTTCTGGCGCCGTTGCCGGGGAAGATTCATAATAGACATTACTTGAACTAATACTT
AAGTATTAGTTCAAGTAATGTCTATTATGAATCTTCCCCGGCAACGGCGCCAGAAATGCTTGTTGGTATTTCTTGACGACATTACTAGAAATATAATTCC[C/T]
AGCAATAACGCAGAAATACTTCTGGTATATTATGGTTACAGAGTTCGTCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCGAGAGTATTCCAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.40% | 8.00% | 36.27% | 26.32% | NA |
| All Indica | 2759 | 4.90% | 1.30% | 53.39% | 40.45% | NA |
| All Japonica | 1512 | 74.90% | 22.20% | 1.59% | 1.39% | NA |
| Aus | 269 | 1.10% | 0.00% | 65.80% | 33.09% | NA |
| Indica I | 595 | 4.70% | 1.30% | 33.61% | 60.34% | NA |
| Indica II | 465 | 6.70% | 0.00% | 55.70% | 37.63% | NA |
| Indica III | 913 | 3.00% | 0.00% | 69.55% | 27.49% | NA |
| Indica Intermediate | 786 | 6.10% | 3.60% | 48.22% | 42.11% | NA |
| Temperate Japonica | 767 | 61.30% | 35.70% | 1.17% | 1.83% | NA |
| Tropical Japonica | 504 | 95.80% | 0.80% | 2.18% | 1.19% | NA |
| Japonica Intermediate | 241 | 74.30% | 23.70% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 6.20% | 6.25% | 3.12% | NA |
| Intermediate | 90 | 43.30% | 2.20% | 37.78% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114869505 | G -> A | LOC_Os11g26000.1 | upstream_gene_variant ; 323.0bp to feature; MODIFIER | silent_mutation | Average:10.559; most accessible tissue: Callus, score: 30.184 | N | N | N | N |
| vg1114869505 | G -> A | LOC_Os11g25990-LOC_Os11g26000 | intergenic_region ; MODIFIER | silent_mutation | Average:10.559; most accessible tissue: Callus, score: 30.184 | N | N | N | N |
| vg1114869505 | G -> DEL | N | N | silent_mutation | Average:10.559; most accessible tissue: Callus, score: 30.184 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114869505 | 7.89E-06 | 1.55E-07 | mr1028 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869505 | NA | 1.55E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869505 | NA | 4.00E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869505 | NA | 3.05E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869505 | 9.77E-06 | 9.76E-06 | mr1424 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869505 | NA | 3.69E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869505 | NA | 4.25E-07 | mr1453 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |