\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114551548:

Variant ID: vg1114551548 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14551548
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGGCCGGGCGCAGAGGTGGACTCACGAGCCTTGCCGCCGCTCTCGGTGGACTCGAGGCCGTCCTCATCGTAGCAAGGAGTGACGATAGCTCCCGTC[A/C]
TCATCCTCCTTCCGCCGCCGCATTCGTCGTCTTCCCCCACGGCGGCGCGCGTGCCCGGAGGGTGGTGCGGCCGGCGACGGCGGCTCCCGAGGAGGCCATC

Reverse complement sequence

GATGGCCTCCTCGGGAGCCGCCGTCGCCGGCCGCACCACCCTCCGGGCACGCGCGCCGCCGTGGGGGAAGACGACGAATGCGGCGGCGGAAGGAGGATGA[T/G]
GACGGGAGCTATCGTCACTCCTTGCTACGATGAGGACGGCCTCGAGTCCACCGAGAGCGGCGGCAAGGCTCGTGAGTCCACCTCTGCGCCCGGCCCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 10.30% 3.09% 0.17% NA
All Indica  2759 97.90% 0.10% 1.67% 0.29% NA
All Japonica  1512 62.00% 31.50% 6.48% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.10% 0.20% 4.37% 0.34% NA
Indica II  465 99.60% 0.00% 0.00% 0.43% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 96.90% 0.30% 2.42% 0.38% NA
Temperate Japonica  767 35.60% 55.70% 8.74% 0.00% NA
Tropical Japonica  504 94.20% 2.40% 3.37% 0.00% NA
Japonica Intermediate  241 78.80% 15.40% 5.81% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114551548 A -> DEL LOC_Os11g25530.1 N frameshift_variant Average:86.31; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1114551548 A -> C LOC_Os11g25530.1 missense_variant ; p.His95Pro; MODERATE nonsynonymous_codon ; H95P Average:86.31; most accessible tissue: Minghui63 panicle, score: 93.735 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1114551548 A C 0.03 0.03 0.04 0.05 0.05 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114551548 1.50E-06 5.05E-09 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114551548 NA 4.05E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114551548 NA 2.27E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114551548 NA 1.51E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114551548 NA 2.20E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114551548 NA 2.33E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114551548 NA 1.36E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251