Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109410604:

Variant ID: vg1109410604 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9410604
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TACAAAGTCACAATCGCCAAGAGCAGATATCATCGATGAAGATCTGCCACAACACAAGGAGAAGGGAATTAAAATAGAATCAAAGGTGAACGTCGATCAC[G/A]
ATGAGACGAAGAGCTCGTGTCCATGGATGCACGCTGACGCCGGTGAGACGATATCGCTCGAGATTATCCATTATTCGTCATGAACAATGGCACACACGGC

Reverse complement sequence

GCCGTGTGTGCCATTGTTCATGACGAATAATGGATAATCTCGAGCGATATCGTCTCACCGGCGTCAGCGTGCATCCATGGACACGAGCTCTTCGTCTCAT[C/T]
GTGATCGACGTTCACCTTTGATTCTATTTTAATTCCCTTCTCCTTGTGTTGTGGCAGATCTTCATCGATGATATCTGCTCTTGGCGATTGTGACTTTGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	7.60%	0.06%	0.59%	NA
All Indica	2759	86.60%	12.70%	0.11%	0.58%	NA
All Japonica	1512	99.10%	0.50%	0.00%	0.46%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	79.70%	17.50%	0.17%	2.69%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	86.20%	13.80%	0.00%	0.00%	NA
Indica Intermediate	786	85.10%	14.80%	0.13%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	0.00%	0.00%	1.39%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	4.40%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109410604	G -> A	LOC_Os11g16970.1	3_prime_UTR_variant ; 71.0bp to feature; MODIFIER	silent_mutation	Average:59.158; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N
vg1109410604	G -> A	LOC_Os11g16960.1	upstream_gene_variant ; 618.0bp to feature; MODIFIER	silent_mutation	Average:59.158; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N
vg1109410604	G -> A	LOC_Os11g16950.1	downstream_gene_variant ; 4227.0bp to feature; MODIFIER	silent_mutation	Average:59.158; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N
vg1109410604	G -> DEL	N	N	silent_mutation	Average:59.158; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109410604	NA	6.02E-06	mr1624	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410604	NA	6.97E-08	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410604	NA	1.46E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410604	NA	1.38E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410604	NA	5.53E-10	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251