Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109410443:

Variant ID: vg1109410443 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9410443
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCATCCTTTCAATTATTGCCAACTATTATATGATAACAAACTGTGCAATTAATATTATCCAACAATATAATGTGCATGACGATTTTATTAATTTCAAA[A/T]
GGACTGTATCATGATAAAGTTCGGATCGATCGAGTATATGGATGAAGATCGATGATCAAATACAAAGTCACAATCGCCAAGAGCAGATATCATCGATGAA

Reverse complement sequence

TTCATCGATGATATCTGCTCTTGGCGATTGTGACTTTGTATTTGATCATCGATCTTCATCCATATACTCGATCGATCCGAACTTTATCATGATACAGTCC[T/A]
TTTGAAATTAATAAAATCGTCATGCACATTATATTGTTGGATAATATTAATTGCACAGTTTGTTATCATATAATAGTTGGCAATAATTGAAAGGATGAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.10% 11.00% 0.02% 0.95% NA
All Indica  2759 80.70% 18.10% 0.04% 1.16% NA
All Japonica  1512 99.30% 0.10% 0.00% 0.53% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 97.30% 0.00% 0.00% 2.69% NA
Indica II  465 47.50% 50.80% 0.00% 1.72% NA
Indica III  913 85.50% 14.10% 0.00% 0.33% NA
Indica Intermediate  786 82.20% 17.00% 0.13% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 0.20% 0.00% 1.59% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 17.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109410443 A -> T LOC_Os11g16970.1 3_prime_UTR_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:48.515; most accessible tissue: Callus, score: 73.512 N N N N
vg1109410443 A -> T LOC_Os11g16960.1 upstream_gene_variant ; 457.0bp to feature; MODIFIER silent_mutation Average:48.515; most accessible tissue: Callus, score: 73.512 N N N N
vg1109410443 A -> T LOC_Os11g16950.1 downstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:48.515; most accessible tissue: Callus, score: 73.512 N N N N
vg1109410443 A -> DEL N N silent_mutation Average:48.515; most accessible tissue: Callus, score: 73.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109410443 NA 8.83E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 1.71E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 9.38E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 1.03E-08 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 1.44E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 1.15E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 5.30E-12 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 6.53E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 1.38E-10 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 2.03E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 9.40E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 3.42E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 7.19E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 2.49E-12 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 1.15E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109410443 NA 4.54E-11 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251