\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108671225:

Variant ID: vg1108671225 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8671225
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.08, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGGATTTGGGTGGTATCTGGAAAAGGCTAGTACCGTCCCCGGTCAATTAAGGACCGAGCCATGAAGTTAAGCATGAAACGACCCTCGTACAACCGCACTT[T/C]
TCGTATGGGTATAGACCTAGCGGAATAGATAGCTGAGCGGAGGCAGTATCCATGCATAGTGGTTTCTTGATGTGTGAGGCAGGGGCTCTACGGTGGGGCA

Reverse complement sequence

TGCCCCACCGTAGAGCCCCTGCCTCACACATCAAGAAACCACTATGCATGGATACTGCCTCCGCTCAGCTATCTATTCCGCTAGGTCTATACCCATACGA[A/G]
AAGTGCGGTTGTACGAGGGTCGTTTCATGCTTAACTTCATGGCTCGGTCCTTAATTGACCGGGGACGGTACTAGCCTTTTCCAGATACCACCCAAATCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 41.90% 12.34% 1.86% NA
All Indica  2759 14.30% 63.00% 19.93% 2.72% NA
All Japonica  1512 90.00% 8.30% 1.26% 0.46% NA
Aus  269 68.80% 28.60% 2.23% 0.37% NA
Indica I  595 4.90% 84.50% 7.90% 2.69% NA
Indica II  465 12.90% 42.80% 38.92% 5.38% NA
Indica III  913 19.10% 64.30% 15.66% 0.99% NA
Indica Intermediate  786 16.80% 57.30% 22.77% 3.18% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 80.00% 18.80% 0.99% 0.20% NA
Japonica Intermediate  241 85.90% 5.80% 5.81% 2.49% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 48.90% 38.90% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108671225 T -> DEL N N silent_mutation Average:19.571; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg1108671225 T -> C LOC_Os11g15320.1 upstream_gene_variant ; 1458.0bp to feature; MODIFIER silent_mutation Average:19.571; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg1108671225 T -> C LOC_Os11g15320-LOC_Os11g15340 intergenic_region ; MODIFIER silent_mutation Average:19.571; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108671225 NA 1.87E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 9.42E-06 7.94E-13 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 3.11E-06 3.33E-09 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 4.63E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 5.05E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 5.71E-13 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 2.78E-09 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 1.82E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 3.15E-09 mr1215_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 8.13E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 1.72E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 2.61E-06 1.78E-13 mr1228_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 3.58E-06 3.58E-06 mr1228_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 1.55E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 4.65E-06 3.09E-06 mr1266_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 5.53E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 3.31E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 2.35E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 6.37E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 3.12E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 1.02E-06 1.02E-06 mr1424_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 2.31E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 3.96E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 9.66E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 1.41E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 6.29E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 3.51E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 2.28E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 2.42E-24 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 1.25E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108671225 NA 1.92E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251