Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108386798:

Variant ID: vg1108386798 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8386798
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCGCTTGATGGCTTCTGGCTTCTCCCGTTCTCCGGCTCTCCACTCTACTCTCCCGGCTACCTACCTTGCACGATTGGTGTGTGCAGCGACTGCGAGTC[C/T]
GCAACTCCGCCTCTCTTTCTCTATCTCCGGCCTCAGGTGCTCAGCACCGCAACAACACCGGCAGCCCGCGGCCGGCGTGGGGCATGCAGCGACCTGCGTG

Reverse complement sequence

CACGCAGGTCGCTGCATGCCCCACGCCGGCCGCGGGCTGCCGGTGTTGTTGCGGTGCTGAGCACCTGAGGCCGGAGATAGAGAAAGAGAGGCGGAGTTGC[G/A]
GACTCGCAGTCGCTGCACACACCAATCGTGCAAGGTAGGTAGCCGGGAGAGTAGAGTGGAGAGCCGGAGAACGGGAGAAGCCAGAAGCCATCAAGCGAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.30%	0.10%	0.61%	0.95%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	95.30%	0.10%	1.72%	2.84%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	88.90%	0.40%	4.17%	6.55%	NA
Japonica Intermediate	241	94.20%	0.00%	1.66%	4.15%	NA
VI/Aromatic	96	91.70%	4.20%	3.12%	1.04%	NA
Intermediate	90	98.90%	0.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108386798	C -> T	LOC_Os11g14900.1	upstream_gene_variant ; 4783.0bp to feature; MODIFIER	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1108386798	C -> T	LOC_Os11g14900.5	upstream_gene_variant ; 4765.0bp to feature; MODIFIER	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1108386798	C -> T	LOC_Os11g14900.2	upstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1108386798	C -> T	LOC_Os11g14900.4	upstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1108386798	C -> T	LOC_Os11g14900.3	upstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1108386798	C -> T	LOC_Os11g14910.1	downstream_gene_variant ; 780.0bp to feature; MODIFIER	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1108386798	C -> T	LOC_Os11g14900-LOC_Os11g14910	intergenic_region ; MODIFIER	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1108386798	C -> DEL	N	N	silent_mutation	Average:67.861; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108386798	NA	2.85E-08	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108386798	NA	4.33E-09	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108386798	5.78E-07	2.25E-08	mr1217_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108386798	NA	2.83E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108386798	NA	6.14E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251