\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108341737:

Variant ID: vg1108341737 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8341737
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGTGGCGCAGTTGTCTATTCAACAACAGAAATAATGAAAATTTCAGAATTAAAAATAAATAATATTAGAAGAAGAGACTAGAGTATATATAGAAATA[C/A]
AATTTACAGATAACGAAAATTTGGAATTAAAAAATATTGAAAGACGAGTCTAGAGTCCATATAGGAATATAATTTACAAATAACTAAAAGCTGATATTAA

Reverse complement sequence

TTAATATCAGCTTTTAGTTATTTGTAAATTATATTCCTATATGGACTCTAGACTCGTCTTTCAATATTTTTTAATTCCAAATTTTCGTTATCTGTAAATT[G/T]
TATTTCTATATATACTCTAGTCTCTTCTTCTAATATTATTTATTTTTAATTCTGAAATTTTCATTATTTCTGTTGTTGAATAGACAACTGCGCCACGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 37.70% 9.78% 10.90% NA
All Indica  2759 6.50% 59.80% 16.13% 17.58% NA
All Japonica  1512 96.00% 2.40% 0.73% 0.86% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 12.10% 37.60% 24.71% 25.55% NA
Indica II  465 2.60% 53.10% 19.14% 25.16% NA
Indica III  913 1.20% 79.30% 10.95% 8.54% NA
Indica Intermediate  786 10.70% 57.90% 13.87% 17.56% NA
Temperate Japonica  767 98.00% 0.30% 0.39% 1.30% NA
Tropical Japonica  504 95.60% 2.80% 1.19% 0.40% NA
Japonica Intermediate  241 90.50% 8.30% 0.83% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 50.00% 25.60% 6.67% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108341737 C -> A LOC_Os11g14830.1 upstream_gene_variant ; 3554.0bp to feature; MODIFIER silent_mutation Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1108341737 C -> A LOC_Os11g14810.1 downstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1108341737 C -> A LOC_Os11g14820.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1108341737 C -> A LOC_Os11g14810-LOC_Os11g14820 intergenic_region ; MODIFIER silent_mutation Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1108341737 C -> DEL N N silent_mutation Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108341737 NA 1.12E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737 NA 2.50E-59 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737 NA 1.62E-32 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737 NA 7.03E-16 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737 NA 4.78E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737 NA 9.64E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737 1.60E-06 1.95E-08 mr1763 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737 NA 4.62E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251