\
| Variant ID: vg1108341737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8341737 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGGCGTGGCGCAGTTGTCTATTCAACAACAGAAATAATGAAAATTTCAGAATTAAAAATAAATAATATTAGAAGAAGAGACTAGAGTATATATAGAAATA[C/A]
AATTTACAGATAACGAAAATTTGGAATTAAAAAATATTGAAAGACGAGTCTAGAGTCCATATAGGAATATAATTTACAAATAACTAAAAGCTGATATTAA
TTAATATCAGCTTTTAGTTATTTGTAAATTATATTCCTATATGGACTCTAGACTCGTCTTTCAATATTTTTTAATTCCAAATTTTCGTTATCTGTAAATT[G/T]
TATTTCTATATATACTCTAGTCTCTTCTTCTAATATTATTTATTTTTAATTCTGAAATTTTCATTATTTCTGTTGTTGAATAGACAACTGCGCCACGCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.60% | 37.70% | 9.78% | 10.90% | NA |
| All Indica | 2759 | 6.50% | 59.80% | 16.13% | 17.58% | NA |
| All Japonica | 1512 | 96.00% | 2.40% | 0.73% | 0.86% | NA |
| Aus | 269 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.10% | 37.60% | 24.71% | 25.55% | NA |
| Indica II | 465 | 2.60% | 53.10% | 19.14% | 25.16% | NA |
| Indica III | 913 | 1.20% | 79.30% | 10.95% | 8.54% | NA |
| Indica Intermediate | 786 | 10.70% | 57.90% | 13.87% | 17.56% | NA |
| Temperate Japonica | 767 | 98.00% | 0.30% | 0.39% | 1.30% | NA |
| Tropical Japonica | 504 | 95.60% | 2.80% | 1.19% | 0.40% | NA |
| Japonica Intermediate | 241 | 90.50% | 8.30% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 50.00% | 25.60% | 6.67% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108341737 | C -> A | LOC_Os11g14830.1 | upstream_gene_variant ; 3554.0bp to feature; MODIFIER | silent_mutation | Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1108341737 | C -> A | LOC_Os11g14810.1 | downstream_gene_variant ; 4397.0bp to feature; MODIFIER | silent_mutation | Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1108341737 | C -> A | LOC_Os11g14820.1 | downstream_gene_variant ; 1366.0bp to feature; MODIFIER | silent_mutation | Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1108341737 | C -> A | LOC_Os11g14810-LOC_Os11g14820 | intergenic_region ; MODIFIER | silent_mutation | Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1108341737 | C -> DEL | N | N | silent_mutation | Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108341737 | NA | 1.12E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108341737 | NA | 2.50E-59 | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108341737 | NA | 1.62E-32 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108341737 | NA | 7.03E-16 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108341737 | NA | 4.78E-31 | mr1224 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108341737 | NA | 9.64E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108341737 | 1.60E-06 | 1.95E-08 | mr1763 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108341737 | NA | 4.62E-12 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |