\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107270469:

Variant ID: vg1107270469 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 7270469
Reference Allele: AAlternative Allele: T,AT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTAGTGTGCATTTTCTAGATATACAACGTATGCACGTATATACATCCTCCGCAGTTATTGCTGTGCAATTACTAAGATCCTGTTCCCAAACAAAAAAA[A/T,AT]
TTTATTCTGTCACATCGAATGTTTGAATACATGCATGAAGTATTAAATATAGACAAAACAAAAACTAATTACACATATTGCGTGTAAAATGCAAGACAAA

Reverse complement sequence

TTTGTCTTGCATTTTACACGCAATATGTGTAATTAGTTTTTGTTTTGTCTATATTTAATACTTCATGCATGTATTCAAACATTCGATGTGACAGAATAAA[T/A,AT]
TTTTTTTGTTTGGGAACAGGATCTTAGTAATTGCACAGCAATAACTGCGGAGGATGTATATACGTGCATACGTTGTATATCTAGAAAATGCACACTACTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 20.10% 0.55% 3.32% AT: 1.42%
All Indica  2759 92.00% 0.80% 0.58% 4.64% AT: 2.07%
All Japonica  1512 44.80% 53.60% 0.40% 0.86% AT: 0.26%
Aus  269 91.40% 1.50% 0.74% 5.20% AT: 1.12%
Indica I  595 87.40% 0.30% 1.01% 4.54% AT: 6.72%
Indica II  465 98.30% 0.60% 0.00% 1.08% NA
Indica III  913 93.30% 0.50% 0.44% 5.04% AT: 0.66%
Indica Intermediate  786 90.10% 1.40% 0.76% 6.36% AT: 1.40%
Temperate Japonica  767 48.90% 50.20% 0.65% 0.00% AT: 0.26%
Tropical Japonica  504 31.50% 65.50% 0.20% 2.58% AT: 0.20%
Japonica Intermediate  241 59.80% 39.80% 0.00% 0.00% AT: 0.41%
VI/Aromatic  96 6.20% 91.70% 0.00% 2.08% NA
Intermediate  90 64.40% 30.00% 2.22% 0.00% AT: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107270469 A -> AT LOC_Os11g12810-LOC_Os11g12830 intergenic_region ; MODIFIER silent_mutation Average:39.768; most accessible tissue: Callus, score: 67.758 N N N N
vg1107270469 A -> T LOC_Os11g12810-LOC_Os11g12830 intergenic_region ; MODIFIER silent_mutation Average:39.768; most accessible tissue: Callus, score: 67.758 N N N N
vg1107270469 A -> DEL N N silent_mutation Average:39.768; most accessible tissue: Callus, score: 67.758 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107270469 NA 1.62E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107270469 1.88E-06 NA mr1790 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107270469 NA 1.63E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107270469 NA 2.87E-07 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251