\
| Variant ID: vg1107270469 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 7270469 |
| Reference Allele: A | Alternative Allele: T,AT |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGTAGTGTGCATTTTCTAGATATACAACGTATGCACGTATATACATCCTCCGCAGTTATTGCTGTGCAATTACTAAGATCCTGTTCCCAAACAAAAAAA[A/T,AT]
TTTATTCTGTCACATCGAATGTTTGAATACATGCATGAAGTATTAAATATAGACAAAACAAAAACTAATTACACATATTGCGTGTAAAATGCAAGACAAA
TTTGTCTTGCATTTTACACGCAATATGTGTAATTAGTTTTTGTTTTGTCTATATTTAATACTTCATGCATGTATTCAAACATTCGATGTGACAGAATAAA[T/A,AT]
TTTTTTTGTTTGGGAACAGGATCTTAGTAATTGCACAGCAATAACTGCGGAGGATGTATATACGTGCATACGTTGTATATCTAGAAAATGCACACTACTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 20.10% | 0.55% | 3.32% | AT: 1.42% |
| All Indica | 2759 | 92.00% | 0.80% | 0.58% | 4.64% | AT: 2.07% |
| All Japonica | 1512 | 44.80% | 53.60% | 0.40% | 0.86% | AT: 0.26% |
| Aus | 269 | 91.40% | 1.50% | 0.74% | 5.20% | AT: 1.12% |
| Indica I | 595 | 87.40% | 0.30% | 1.01% | 4.54% | AT: 6.72% |
| Indica II | 465 | 98.30% | 0.60% | 0.00% | 1.08% | NA |
| Indica III | 913 | 93.30% | 0.50% | 0.44% | 5.04% | AT: 0.66% |
| Indica Intermediate | 786 | 90.10% | 1.40% | 0.76% | 6.36% | AT: 1.40% |
| Temperate Japonica | 767 | 48.90% | 50.20% | 0.65% | 0.00% | AT: 0.26% |
| Tropical Japonica | 504 | 31.50% | 65.50% | 0.20% | 2.58% | AT: 0.20% |
| Japonica Intermediate | 241 | 59.80% | 39.80% | 0.00% | 0.00% | AT: 0.41% |
| VI/Aromatic | 96 | 6.20% | 91.70% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 30.00% | 2.22% | 0.00% | AT: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107270469 | A -> AT | LOC_Os11g12810-LOC_Os11g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:39.768; most accessible tissue: Callus, score: 67.758 | N | N | N | N |
| vg1107270469 | A -> T | LOC_Os11g12810-LOC_Os11g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:39.768; most accessible tissue: Callus, score: 67.758 | N | N | N | N |
| vg1107270469 | A -> DEL | N | N | silent_mutation | Average:39.768; most accessible tissue: Callus, score: 67.758 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107270469 | NA | 1.62E-10 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107270469 | 1.88E-06 | NA | mr1790 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107270469 | NA | 1.63E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107270469 | NA | 2.87E-07 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |