Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107011614:

Variant ID: vg1107011614 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7011614
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CATTCAGTTTTGTACTCCTAAACATTCGTGATGATTCTTAAGAACAACTCCGACCCTCTGCCAACCAAATATTCATATATGTACAAATCCATTTTAAAAT[A/C]
TCGGTATAAAAGCATGACAAAATCAGAGGTTTAAACTATAATTAAAGTGGACTACTACCTTAATTGTCAACCATTTTACATAATACCTGCAAATGCATTA

Reverse complement sequence

TAATGCATTTGCAGGTATTATGTAAAATGGTTGACAATTAAGGTAGTAGTCCACTTTAATTATAGTTTAAACCTCTGATTTTGTCATGCTTTTATACCGA[T/G]
ATTTTAAAATGGATTTGTACATATATGAATATTTGGTTGGCAGAGGGTCGGAGTTGTTCTTAAGAATCATCACGAATGTTTAGGAGTACAAAACTGAATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.50% 0.19% 0.00% NA
All Indica  2759 86.30% 13.60% 0.11% 0.00% NA
All Japonica  1512 23.50% 76.20% 0.33% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 91.60% 8.40% 0.00% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 81.50% 18.40% 0.11% 0.00% NA
Indica Intermediate  786 83.00% 16.80% 0.25% 0.00% NA
Temperate Japonica  767 24.80% 74.80% 0.39% 0.00% NA
Tropical Japonica  504 23.20% 76.40% 0.40% 0.00% NA
Japonica Intermediate  241 19.90% 80.10% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 76.00% 1.04% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107011614 A -> C LOC_Os11g12530.1 3_prime_UTR_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:65.619; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg1107011614 A -> C LOC_Os11g12520.1 downstream_gene_variant ; 4379.0bp to feature; MODIFIER silent_mutation Average:65.619; most accessible tissue: Minghui63 root, score: 90.598 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1107011614 A C -0.21 -0.02 -0.01 -0.02 -0.03 -0.02