Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105978901:

Variant ID: vg1105978901 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5978901
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCACCGCGGCAGCTCGGTGACGGCGAAGGGCCGCATCGACATGGACGCCGGCGAGCGCGAGTCGGTGGTGATCGGCGGCACGGGGCGGTTCCGGCTCG[C/T]
GCGCGGGTACATGGTCACCAAGAACTACGACTACAGCCTCGCCACCGGTGGCATCGTCGAGATCGACCTCTACCTGAAGCACTAGCTAGAAGTAGCACGG

Reverse complement sequence

CCGTGCTACTTCTAGCTAGTGCTTCAGGTAGAGGTCGATCTCGACGATGCCACCGGTGGCGAGGCTGTAGTCGTAGTTCTTGGTGACCATGTACCCGCGC[G/A]
CGAGCCGGAACCGCCCCGTGCCGCCGATCACCACCGACTCGCGCTCGCCGGCGTCCATGTCGATGCGGCCCTTCGCCGTCACCGAGCTGCCGCGGTGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 11.50% 0.06% 0.00% NA
All Indica  2759 84.50% 15.40% 0.07% 0.00% NA
All Japonica  1512 93.00% 6.90% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 91.60% 8.40% 0.00% 0.00% NA
Indica III  913 74.30% 25.70% 0.00% 0.00% NA
Indica Intermediate  786 81.30% 18.60% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 82.50% 17.50% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105978901 C -> T LOC_Os11g10850.1 missense_variant ; p.Ala162Val; MODERATE nonsynonymous_codon ; A162V Average:89.311; most accessible tissue: Zhenshan97 flag leaf, score: 96.97 benign 1.453 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105978901 C T -0.02 -0.01 -0.01 -0.03 -0.03 -0.03