Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105978628:

Variant ID: vg1105978628 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5978628
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCACGACGCCTACACCGGCCCGGCTCCCACCGCCATGCGCGTCGTCTCCGGCCGCTCCCTGCTCGACGGCGACAACGGCAACGGCAACGGCAACGGCG[A/G]
CGACGGCTCGCCGCCGCGGCAGTTCGGCGACATCGTGGCGCTGAACAACGCGCTGACGGAGGGGCCATCCGCCGGCAGCGCGCGCGTGGGCACGGCGCAG

Reverse complement sequence

CTGCGCCGTGCCCACGCGCGCGCTGCCGGCGGATGGCCCCTCCGTCAGCGCGTTGTTCAGCGCCACGATGTCGCCGAACTGCCGCGGCGGCGAGCCGTCG[T/C]
CGCCGTTGCCGTTGCCGTTGCCGTTGTCGCCGTCGAGCAGGGAGCGGCCGGAGACGACGCGCATGGCGGTGGGAGCCGGGCCGGTGTAGGCGTCGTGCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	46.90%	0.49%	0.11%	NA
All Indica	2759	70.40%	29.00%	0.62%	0.04%	NA
All Japonica	1512	17.50%	82.00%	0.26%	0.26%	NA
Aus	269	85.50%	14.10%	0.37%	0.00%	NA
Indica I	595	67.40%	31.40%	1.01%	0.17%	NA
Indica II	465	79.80%	19.60%	0.65%	0.00%	NA
Indica III	913	69.90%	30.10%	0.00%	0.00%	NA
Indica Intermediate	786	67.60%	31.40%	1.02%	0.00%	NA
Temperate Japonica	767	27.50%	71.40%	0.52%	0.52%	NA
Tropical Japonica	504	4.80%	95.20%	0.00%	0.00%	NA
Japonica Intermediate	241	12.00%	88.00%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105978628	A -> DEL	LOC_Os11g10850.1	N	frameshift_variant	Average:86.665; most accessible tissue: Zhenshan97 flag leaf, score: 96.336	N	N	N	N
vg1105978628	A -> G	LOC_Os11g10850.1	missense_variant ; p.Asp71Gly; MODERATE	nonsynonymous_codon ; D71G	Average:86.665; most accessible tissue: Zhenshan97 flag leaf, score: 96.336	unknown	unknown	TOLERATED	0.39

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1105978628	A	G	-0.01	0.0	0.0	0.01	0.01	0.0