Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105978598:

Variant ID: vg1105978598 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 5978598
Reference Allele: GCGACAACGGCAACGGCAACGGCAA	Alternative Allele: G
Primary Allele: GCGACAACGGCAACGGCAAC GGCAA	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCACCACCACCACCCACCTCCACTTCTACATGCACGACGCCTACACCGGCCCGGCTCCCACCGCCATGCGCGTCGTCTCCGGCCGCTCCCTGCTCGACG[GCGACAACGGCAACGGCAACGGCAA/G]
CGGCGACGACGGCTCGCCGCCGCGGCAGTTCGGCGACATCGTGGCGCTGAACAACGCGCTGACGGAGGGGCCATCCGCCGGCAGCGCGCGCGTGGGCACG

Reverse complement sequence

CGTGCCCACGCGCGCGCTGCCGGCGGATGGCCCCTCCGTCAGCGCGTTGTTCAGCGCCACGATGTCGCCGAACTGCCGCGGCGGCGAGCCGTCGTCGCCG[TTGCCGTTGCCGTTGCCGTTGTCGC/C]
CGTCGAGCAGGGAGCGGCCGGAGACGACGCGCATGGCGGTGGGAGCCGGGCCGGTGTAGGCGTCGTGCATGTAGAAGTGGAGGTGGGTGGTGGTGGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of GCGACAACGGCAACGGCAAC GGCAA(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.90%	33.50%	8.27%	9.35%	NA
All Indica	2759	31.50%	43.20%	11.85%	13.48%	NA
All Japonica	1512	82.90%	11.60%	2.38%	3.04%	NA
Aus	269	16.70%	69.90%	8.55%	4.83%	NA
Indica I	595	35.50%	37.50%	14.62%	12.44%	NA
Indica II	465	22.20%	49.50%	13.12%	15.27%	NA
Indica III	913	30.30%	44.70%	10.41%	14.57%	NA
Indica Intermediate	786	35.20%	42.10%	10.69%	11.96%	NA
Temperate Japonica	767	72.50%	18.50%	4.04%	4.95%	NA
Tropical Japonica	504	96.20%	2.40%	0.60%	0.79%	NA
Japonica Intermediate	241	88.40%	9.10%	0.83%	1.66%	NA
VI/Aromatic	96	88.50%	8.30%	1.04%	2.08%	NA
Intermediate	90	63.30%	22.20%	4.44%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105978598	GCGACAACGGCAACGGCAACGGCAA -> DEL	LOC_Os11g10850.1	N	frameshift_variant	Average:87.171; most accessible tissue: Zhenshan97 flag leaf, score: 97.105	N	N	N	N
vg1105978598	GCGACAACGGCAACGGCAACGGCAA -> G	LOC_Os11g10850.1	disruptive_inframe_deletion ; p.Asp62_Asn69del; MODERATE	inframe_variant	Average:87.171; most accessible tissue: Zhenshan97 flag leaf, score: 97.105	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1105978598	GCGAC*	G	0.09	0.09	0.05	-0.14	-0.14	-0.12