Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105978552:

Variant ID: vg1105978552 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5978552
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCCTCGCAGCCGCCGTCTTCCTCCACCGCAACGGCGCCTCCACCACCACCACCACCACCCACCTCCACTTCTACATGCACGACGCCTACACCGGCCCG[G/T]
CTCCCACCGCCATGCGCGTCGTCTCCGGCCGCTCCCTGCTCGACGGCGACAACGGCAACGGCAACGGCAACGGCGACGACGGCTCGCCGCCGCGGCAGTT

Reverse complement sequence

AACTGCCGCGGCGGCGAGCCGTCGTCGCCGTTGCCGTTGCCGTTGCCGTTGTCGCCGTCGAGCAGGGAGCGGCCGGAGACGACGCGCATGGCGGTGGGAG[C/A]
CGGGCCGGTGTAGGCGTCGTGCATGTAGAAGTGGAGGTGGGTGGTGGTGGTGGTGGTGGAGGCGCCGTTGCGGTGGAGGAAGACGGCGGCTGCGAGGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 47.10% 0.72% 0.00% NA
All Indica  2759 70.00% 29.10% 0.91% 0.00% NA
All Japonica  1512 17.30% 82.30% 0.33% 0.00% NA
Aus  269 85.50% 13.80% 0.74% 0.00% NA
Indica I  595 67.40% 31.40% 1.18% 0.00% NA
Indica II  465 79.80% 19.10% 1.08% 0.00% NA
Indica III  913 70.10% 29.80% 0.11% 0.00% NA
Indica Intermediate  786 66.20% 32.30% 1.53% 0.00% NA
Temperate Japonica  767 27.90% 71.60% 0.52% 0.00% NA
Tropical Japonica  504 3.60% 96.20% 0.20% 0.00% NA
Japonica Intermediate  241 12.40% 87.60% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105978552 G -> T LOC_Os11g10850.1 missense_variant ; p.Ala46Ser; MODERATE nonsynonymous_codon ; A46S Average:90.656; most accessible tissue: Zhenshan97 flag leaf, score: 96.683 benign 0.093 TOLERATED 0.77

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105978552 G T -0.05 -0.03 -0.03 -0.04 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105978552 NA 6.56E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105978552 NA 7.99E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105978552 NA 4.33E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105978552 NA 9.65E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105978552 NA 7.95E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251