\
| Variant ID: vg1105850724 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5850724 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 77. )
CAACCTGTGGCGATAGGACTACTAAGGCACGACTGAAGACATCGAGCAACTCCGACTTCCTAAGACAAGCCAGAACATACCAACAAACCCACCAAGGAGC[G/A]
GGAATTACTAGGCGAAGCCTCCGACAAGGAAACAATATCAAGAATGTTGTCAATGTCCGTCCATAGCAATATACTAGGTTTTCATCTAAAGAAGAAGATG
CATCTTCTTCTTTAGATGAAAACCTAGTATATTGCTATGGACGGACATTGACAACATTCTTGATATTGTTTCCTTGTCGGAGGCTTCGCCTAGTAATTCC[C/T]
GCTCCTTGGTGGGTTTGTTGGTATGTTCTGGCTTGTCTTAGGAAGTCGGAGTTGCTCGATGTCTTCAGTCGTGCCTTAGTAGTCCTATCGCCACAGGTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.90% | 9.70% | 1.10% | 43.27% | NA |
| All Indica | 2759 | 18.40% | 10.70% | 1.74% | 69.16% | NA |
| All Japonica | 1512 | 92.50% | 2.20% | 0.13% | 5.16% | NA |
| Aus | 269 | 48.30% | 42.80% | 0.74% | 8.18% | NA |
| Indica I | 595 | 7.70% | 9.10% | 0.67% | 82.52% | NA |
| Indica II | 465 | 9.00% | 5.40% | 3.23% | 82.37% | NA |
| Indica III | 913 | 26.50% | 11.20% | 1.53% | 60.79% | NA |
| Indica Intermediate | 786 | 22.60% | 14.50% | 1.91% | 60.94% | NA |
| Temperate Japonica | 767 | 91.80% | 1.40% | 0.26% | 6.52% | NA |
| Tropical Japonica | 504 | 97.40% | 1.00% | 0.00% | 1.59% | NA |
| Japonica Intermediate | 241 | 84.20% | 7.50% | 0.00% | 8.30% | NA |
| VI/Aromatic | 96 | 91.70% | 5.20% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 51.10% | 11.10% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105850724 | G -> A | LOC_Os11g10670.1 | downstream_gene_variant ; 1329.0bp to feature; MODIFIER | silent_mutation | Average:15.416; most accessible tissue: Callus, score: 79.62 | N | N | N | N |
| vg1105850724 | G -> A | LOC_Os11g10650-LOC_Os11g10670 | intergenic_region ; MODIFIER | silent_mutation | Average:15.416; most accessible tissue: Callus, score: 79.62 | N | N | N | N |
| vg1105850724 | G -> DEL | N | N | silent_mutation | Average:15.416; most accessible tissue: Callus, score: 79.62 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105850724 | NA | 3.99E-06 | mr1419 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105850724 | 3.36E-06 | 3.36E-06 | mr1419 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105850724 | NA | 4.62E-07 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105850724 | NA | 2.03E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105850724 | NA | 5.68E-07 | mr1863 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105850724 | 6.54E-06 | 6.54E-06 | mr1863 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |