| Variant ID: vg1105604028 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5604028 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 103. )
GGAATCCGGAAAGTTTATGTACCGTTTTCACCCGTGGCCCACAACGAGACCAAAATTGAGGGTGTTGACGCTGATTCAGGTCACATTTTTACTATCAACG[G/T]
AGGGCATGCATTTACAACACGAATTGATATAAACCATCTACAAGAGATGCCAACTACTCCCTCCGGTTTCATTTTAATTGACACTTTGGACAATGACACG
CGTGTCATTGTCCAAAGTGTCAATTAAAATGAAACCGGAGGGAGTAGTTGGCATCTCTTGTAGATGGTTTATATCAATTCGTGTTGTAAATGCATGCCCT[C/A]
CGTTGATAGTAAAAATGTGACCTGAATCAGCGTCAACACCCTCAATTTTGGTCTCGTTGTGGGCCACGGGTGAAAACGGTACATAAACTTTCCGGATTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 22.30% | 0.47% | 9.29% | NA |
| All Indica | 2759 | 57.70% | 36.50% | 0.65% | 5.15% | NA |
| All Japonica | 1512 | 85.20% | 1.50% | 0.07% | 13.29% | NA |
| Aus | 269 | 97.00% | 0.00% | 0.00% | 2.97% | NA |
| Indica I | 595 | 85.90% | 1.00% | 2.02% | 11.09% | NA |
| Indica II | 465 | 17.40% | 81.30% | 0.22% | 1.08% | NA |
| Indica III | 913 | 59.70% | 35.30% | 0.33% | 4.71% | NA |
| Indica Intermediate | 786 | 57.80% | 38.40% | 0.25% | 3.56% | NA |
| Temperate Japonica | 767 | 88.90% | 2.20% | 0.00% | 8.87% | NA |
| Tropical Japonica | 504 | 88.10% | 0.40% | 0.20% | 11.31% | NA |
| Japonica Intermediate | 241 | 67.20% | 1.20% | 0.00% | 31.54% | NA |
| VI/Aromatic | 96 | 12.50% | 2.10% | 2.08% | 83.33% | NA |
| Intermediate | 90 | 67.80% | 22.20% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105604028 | G -> T | LOC_Os11g10310.1 | upstream_gene_variant ; 951.0bp to feature; MODIFIER | silent_mutation | Average:43.192; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg1105604028 | G -> T | LOC_Os11g10320.1 | upstream_gene_variant ; 1215.0bp to feature; MODIFIER | silent_mutation | Average:43.192; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg1105604028 | G -> T | LOC_Os11g10310-LOC_Os11g10320 | intergenic_region ; MODIFIER | silent_mutation | Average:43.192; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg1105604028 | G -> DEL | N | N | silent_mutation | Average:43.192; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105604028 | NA | 1.45E-12 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1105604028 | NA | 8.52E-17 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1105604028 | NA | 1.80E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105604028 | NA | 7.39E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105604028 | NA | 2.38E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105604028 | NA | 8.85E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105604028 | NA | 2.44E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105604028 | NA | 1.96E-14 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105604028 | NA | 5.02E-08 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105604028 | NA | 4.15E-07 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/