\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105377831:

Variant ID: vg1105377831 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5377831
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGGCCTCTGTTGCCTATAGGGCCACCGTCATCGTTGGGATCCTCTTTCGCCTCCCAAACTCCCAGTCCGTTGTCACCCCTAGGGCCACCGCCACCGCC[A/G]
GGGTCCACATTTCTTGGAAAAAAAACTCAGTCCTCTGCCGCCCACACTCCCAGTCGTTTAATGTAATCATTTTGTAAACAAAAATCTAATAAAAGCTCTT

Reverse complement sequence

AAGAGCTTTTATTAGATTTTTGTTTACAAAATGATTACATTAAACGACTGGGAGTGTGGGCGGCAGAGGACTGAGTTTTTTTTCCAAGAAATGTGGACCC[T/C]
GGCGGTGGCGGTGGCCCTAGGGGTGACAACGGACTGGGAGTTTGGGAGGCGAAAGAGGATCCCAACGATGACGGTGGCCCTATAGGCAACAGAGGCCTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 2.60% 0.34% 10.92% NA
All Indica  2759 77.50% 4.40% 0.51% 17.62% NA
All Japonica  1512 99.00% 0.10% 0.07% 0.86% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.10% 2.70% 0.34% 0.84% NA
Indica II  465 36.10% 0.90% 1.51% 61.51% NA
Indica III  913 91.50% 1.80% 0.00% 6.79% NA
Indica Intermediate  786 71.50% 10.90% 0.64% 16.92% NA
Temperate Japonica  767 98.30% 0.00% 0.13% 1.56% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 2.20% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105377831 A -> DEL N N silent_mutation Average:46.573; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1105377831 A -> G LOC_Os11g10040.1 downstream_gene_variant ; 2301.0bp to feature; MODIFIER silent_mutation Average:46.573; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1105377831 A -> G LOC_Os11g10050.1 downstream_gene_variant ; 593.0bp to feature; MODIFIER silent_mutation Average:46.573; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1105377831 A -> G LOC_Os11g10040.2 downstream_gene_variant ; 2308.0bp to feature; MODIFIER silent_mutation Average:46.573; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1105377831 A -> G LOC_Os11g10040.3 downstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:46.573; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1105377831 A -> G LOC_Os11g10040-LOC_Os11g10050 intergenic_region ; MODIFIER silent_mutation Average:46.573; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105377831 NA 2.66E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 2.67E-06 2.67E-06 mr1048_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 6.25E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 2.39E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 5.03E-07 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 8.62E-06 mr1182_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 4.53E-06 NA mr1204_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 8.33E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 1.99E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 9.06E-06 4.48E-06 mr1298_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 4.33E-06 NA mr1310_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 1.93E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 6.39E-06 mr1366_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 8.21E-06 8.21E-06 mr1372_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 9.23E-06 9.23E-06 mr1405_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 1.94E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 4.06E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 8.81E-06 NA mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 4.66E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 8.99E-06 4.79E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 8.58E-06 mr1731_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 2.02E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 1.54E-06 4.13E-07 mr1800_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 5.30E-06 5.30E-06 mr1804_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 1.42E-06 1.42E-06 mr1852_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 4.92E-06 1.48E-06 mr1906_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 5.86E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 1.89E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 6.82E-06 6.82E-06 mr1953_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 2.12E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105377831 NA 1.16E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251