\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103187142:

Variant ID: vg1103187142 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 3187142
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAACAAGCATGCATTAAAGTATAACCATAAAATAAAGATTTTACAATTAAGCTTGAATCATCAATCAAAATTCATGATTTCATACGATTTATAATGCAA[T/C]
ATCTTAACAAGCACATAGGTTGAAGAATAAACACTAAACACATATACCTATTGCATTTATCACTCTTTCTCAAATAACCTTTAGCACAAAACAACAAAGA

Reverse complement sequence

TCTTTGTTGTTTTGTGCTAAAGGTTATTTGAGAAAGAGTGATAAATGCAATAGGTATATGTGTTTAGTGTTTATTCTTCAACCTATGTGCTTGTTAAGAT[A/G]
TTGCATTATAAATCGTATGAAATCATGAATTTTGATTGATGATTCAAGCTTAATTGTAAAATCTTTATTTTATGGTTATACTTTAATGCATGCTTGTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 0.10% 1.29% 52.45% NA
All Indica  2759 18.80% 0.20% 1.96% 79.09% NA
All Japonica  1512 95.40% 0.00% 0.07% 4.50% NA
Aus  269 28.30% 0.40% 1.49% 69.89% NA
Indica I  595 23.20% 0.00% 3.36% 73.45% NA
Indica II  465 18.70% 0.40% 1.29% 79.57% NA
Indica III  913 14.00% 0.10% 1.64% 84.23% NA
Indica Intermediate  786 21.00% 0.30% 1.65% 77.10% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 89.70% 0.00% 0.20% 10.12% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 62.20% 0.00% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1103187142 T -> DEL N N silent_mutation Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N
vg1103187142 T -> C LOC_Os11g06590.1 upstream_gene_variant ; 2973.0bp to feature; MODIFIER silent_mutation Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N
vg1103187142 T -> C LOC_Os11g06595.1 downstream_gene_variant ; 2030.0bp to feature; MODIFIER silent_mutation Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N
vg1103187142 T -> C LOC_Os11g06600.1 downstream_gene_variant ; 722.0bp to feature; MODIFIER silent_mutation Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N
vg1103187142 T -> C LOC_Os11g06595-LOC_Os11g06600 intergenic_region ; MODIFIER silent_mutation Average:14.357; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1103187142 2.07E-06 NA mr1893_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103187142 1.82E-07 5.34E-07 mr1893_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251