\
| Variant ID: vg1102449959 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 2449959 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 111. )
CGTGTGTTTCCACAGCTTGTTCGTCGATCACTTAGGGAAACCTGTCACTTAAGGGCGGCGGAGCTCGACGACGAGGCGGCCTTTCCGTGATGCGACGAGG[C/T]
GGGAGTTCTTGAAGAGGCCGGGGTTGTCAAACACCCTGTCAAGCTCGCCGCCGCCGAACCTGGAGGAGGCCGAGGGCAACGGGATGAACCGAGGCAGCGC
GCGCTGCCTCGGTTCATCCCGTTGCCCTCGGCCTCCTCCAGGTTCGGCGGCGGCGAGCTTGACAGGGTGTTTGACAACCCCGGCCTCTTCAAGAACTCCC[G/A]
CCTCGTCGCATCACGGAAAGGCCGCCTCGTCGTCGAGCTCCGCCGCCCTTAAGTGACAGGTTTCCCTAAGTGATCGACGAACAAGCTGTGGAAACACACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.90% | 19.60% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 70.30% | 29.00% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 43.90% | 55.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 62.40% | 36.90% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 73.30% | 25.40% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1102449959 | C -> T | LOC_Os11g05460.1 | missense_variant ; p.Arg113His; MODERATE | nonsynonymous_codon ; R113H | Average:52.638; most accessible tissue: Zhenshan97 panicle, score: 79.071 | probably damaging |
2.235 |
TOLERATED | 0.16 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1102449959 | NA | 7.99E-06 | mr1333 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 4.62E-07 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 1.52E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 2.53E-09 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 4.77E-07 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 1.37E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 3.76E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 3.57E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 1.76E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 1.23E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 6.31E-12 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 7.46E-06 | mr1611_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 2.46E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 5.90E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 4.82E-09 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1102449959 | NA | 1.16E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |