Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101694274:

Variant ID: vg1101694274 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1694274
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGCTAGTTGTTGGGAAGATGGATTTGTTCCTTCTTTCTGTTCAGTCATCTTGTACACTACATGATTGAATCCTACCTGATTAGAAAGCCCAAAAGATT[A/G]
CTGGTACATTCAACAAGAACAGAGAAAGCATGCCTCTACTGCTTGTTGACAGATAAACCATTGAGGGAAGAACAGTAAAATGGTTGGAGGTTTTCAGAAC

Reverse complement sequence

GTTCTGAAAACCTCCAACCATTTTACTGTTCTTCCCTCAATGGTTTATCTGTCAACAAGCAGTAGAGGCATGCTTTCTCTGTTCTTGTTGAATGTACCAG[T/C]
AATCTTTTGGGCTTTCTAATCAGGTAGGATTCAATCATGTAGTGTACAAGATGACTGAACAGAAAGAAGGAACAAATCCATCTTCCCAACAACTAGCCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	44.90%	0.11%	0.23%	NA
All Indica	2759	29.20%	70.20%	0.18%	0.33%	NA
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	57.60%	41.60%	0.00%	0.74%	NA
Indica I	595	84.90%	14.30%	0.50%	0.34%	NA
Indica II	465	12.50%	87.30%	0.00%	0.22%	NA
Indica III	913	3.60%	96.40%	0.00%	0.00%	NA
Indica Intermediate	786	26.80%	72.10%	0.25%	0.76%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101694274	A -> DEL	N	N	silent_mutation	Average:25.671; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1101694274	A -> G	LOC_Os11g04170.1	3_prime_UTR_variant ; 257.0bp to feature; MODIFIER	silent_mutation	Average:25.671; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1101694274	A -> G	LOC_Os11g04160.1	downstream_gene_variant ; 2934.0bp to feature; MODIFIER	silent_mutation	Average:25.671; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1101694274	A -> G	LOC_Os11g04174.1	downstream_gene_variant ; 198.0bp to feature; MODIFIER	silent_mutation	Average:25.671; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg1101694274	A -> G	LOC_Os11g04180.1	downstream_gene_variant ; 2153.0bp to feature; MODIFIER	silent_mutation	Average:25.671; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101694274	NA	1.48E-10	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	2.64E-10	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	1.06E-07	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	1.89E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	6.23E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	3.83E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	1.75E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	8.84E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	1.42E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	2.04E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	4.10E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	6.72E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	2.81E-09	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	3.77E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	6.43E-14	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101694274	NA	3.28E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251