\
| Variant ID: vg1101299110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 1299110 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )
AATTAATTGTCACTTACCTTTCATATGCTGGGAACAGATTTTTGCAGCAGTTAGTACTTTCTTGGTGGTTATCATCTGCTTAGTACACTGTTGTTCTCTT[C/T]
TTCTGACTTCTGAGCTGCCGTAGCACAAATTTACTTGATGGCTTTCATTTTACTAAAAGAAAAAATTAAGGTGTAGGTGCGGTTATTATAGTATGTTATT
AATAACATACTATAATAACCGCACCTACACCTTAATTTTTTCTTTTAGTAAAATGAAAGCCATCAAGTAAATTTGTGCTACGGCAGCTCAGAAGTCAGAA[G/A]
AAGAGAACAACAGTGTACTAAGCAGATGATAACCACCAAGAAAGTACTAACTGCTGCAAAAATCTGTTCCCAGCATATGAAAGGTAAGTGACAATTAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.70% | 33.80% | 4.74% | 10.71% | NA |
| All Indica | 2759 | 75.20% | 1.80% | 6.63% | 16.31% | NA |
| All Japonica | 1512 | 3.60% | 96.40% | 0.00% | 0.07% | NA |
| Aus | 269 | 56.10% | 9.70% | 14.13% | 20.07% | NA |
| Indica I | 595 | 71.60% | 2.90% | 10.25% | 15.29% | NA |
| Indica II | 465 | 90.80% | 1.50% | 3.87% | 3.87% | NA |
| Indica III | 913 | 69.30% | 0.70% | 5.48% | 24.53% | NA |
| Indica Intermediate | 786 | 75.70% | 2.50% | 6.87% | 14.89% | NA |
| Temperate Japonica | 767 | 2.90% | 97.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 42.20% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1101299110 | C -> T | LOC_Os11g03420.1 | downstream_gene_variant ; 117.0bp to feature; MODIFIER | silent_mutation | Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946 | N | N | N | N |
| vg1101299110 | C -> T | LOC_Os11g03420-LOC_Os11g03430 | intergenic_region ; MODIFIER | silent_mutation | Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946 | N | N | N | N |
| vg1101299110 | C -> DEL | N | N | silent_mutation | Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1101299110 | 1.92E-06 | NA | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 2.64E-08 | 2.64E-09 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 2.42E-08 | NA | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 1.13E-10 | 2.83E-11 | mr1389 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 1.33E-08 | NA | mr1038_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 1.78E-11 | 1.81E-11 | mr1038_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 2.05E-06 | NA | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 4.00E-07 | 1.40E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101299110 | 1.70E-09 | 1.57E-09 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |