\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101299110:

Variant ID: vg1101299110 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1299110
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAATTGTCACTTACCTTTCATATGCTGGGAACAGATTTTTGCAGCAGTTAGTACTTTCTTGGTGGTTATCATCTGCTTAGTACACTGTTGTTCTCTT[C/T]
TTCTGACTTCTGAGCTGCCGTAGCACAAATTTACTTGATGGCTTTCATTTTACTAAAAGAAAAAATTAAGGTGTAGGTGCGGTTATTATAGTATGTTATT

Reverse complement sequence

AATAACATACTATAATAACCGCACCTACACCTTAATTTTTTCTTTTAGTAAAATGAAAGCCATCAAGTAAATTTGTGCTACGGCAGCTCAGAAGTCAGAA[G/A]
AAGAGAACAACAGTGTACTAAGCAGATGATAACCACCAAGAAAGTACTAACTGCTGCAAAAATCTGTTCCCAGCATATGAAAGGTAAGTGACAATTAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 33.80% 4.74% 10.71% NA
All Indica  2759 75.20% 1.80% 6.63% 16.31% NA
All Japonica  1512 3.60% 96.40% 0.00% 0.07% NA
Aus  269 56.10% 9.70% 14.13% 20.07% NA
Indica I  595 71.60% 2.90% 10.25% 15.29% NA
Indica II  465 90.80% 1.50% 3.87% 3.87% NA
Indica III  913 69.30% 0.70% 5.48% 24.53% NA
Indica Intermediate  786 75.70% 2.50% 6.87% 14.89% NA
Temperate Japonica  767 2.90% 97.00% 0.00% 0.13% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 53.30% 42.20% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101299110 C -> T LOC_Os11g03420.1 downstream_gene_variant ; 117.0bp to feature; MODIFIER silent_mutation Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946 N N N N
vg1101299110 C -> T LOC_Os11g03420-LOC_Os11g03430 intergenic_region ; MODIFIER silent_mutation Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946 N N N N
vg1101299110 C -> DEL N N silent_mutation Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101299110 1.92E-06 NA mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 2.64E-08 2.64E-09 mr1038 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 2.42E-08 NA mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 1.13E-10 2.83E-11 mr1389 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 1.33E-08 NA mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 1.78E-11 1.81E-11 mr1038_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 2.05E-06 NA mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 4.00E-07 1.40E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110 1.70E-09 1.57E-09 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251