Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100959851:

Variant ID: vg1100959851 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 959851
Reference Allele: CAlternative Allele: CT
Primary Allele: CSecondary Allele: CT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATGCCGTTAGTTATTTAAGCATGCGAGCCACATGTGGTGGGCTTATGATGGCAACCATAGTGAATATTGAACAAGTTGGCAACTCACGAGCCATCCT[C/CT]
TGTGTCCTTGATGTCCATCTTTGTTGAGCACCTTGACTGCAACAGGTAGTGACTTCAGACCAACCCTGACATTCTCATCTATGTAGCCCTTGTAAACAGT

Reverse complement sequence

ACTGTTTACAAGGGCTACATAGATGAGAATGTCAGGGTTGGTCTGAAGTCACTACCTGTTGCAGTCAAGGTGCTCAACAAAGATGGACATCAAGGACACA[G/AG]
AGGATGGCTCGTGAGTTGCCAACTTGTTCAATATTCACTATGGTTGCCATCATAAGCCCACCACATGTGGCTCGCATGCTTAAATAACTAACGGCATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 4.50% 0.00% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 55.40% 44.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100959851 C CT 0.28 0.1 0.01 0.02 0.1 0.15