Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100750967:

Variant ID: vg1100750967 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 750967
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GATGATGATCTTCTTGGCTTTCCAACGACATGGTTGTCAGCTGCAACATCTGCTGCAGGGGAACTACTGTTCGCTGGAGTCGCCGCCTCTGCTTTGATCA[A/T]
GCTCATCACCGGAACGGCAGCAGCAGCAGCAGAAGAAGAAGCATGTGGTTGGTTCATGACGGAGAGGGCGACGTTGAGGGCTCGCAGGGCGTGGTTGAGG

Reverse complement sequence

CCTCAACCACGCCCTGCGAGCCCTCAACGTCGCCCTCTCCGTCATGAACCAACCACATGCTTCTTCTTCTGCTGCTGCTGCTGCCGTTCCGGTGATGAGC[T/A]
TGATCAAAGCAGAGGCGGCGACTCCAGCGAACAGTAGTTCCCCTGCAGCAGATGTTGCAGCTGACAACCATGTCGTTGGAAAGCCAAGAAGATCATCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.00% 0.08% 0.08% NA
All Indica  2759 96.10% 3.80% 0.04% 0.11% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 38.30% 61.30% 0.00% 0.37% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 87.10% 12.30% 0.22% 0.43% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.00% 0.00% 0.13% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 37.80% 58.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100750967 A -> T LOC_Os11g02470.1 missense_variant ; p.Leu82Met; MODERATE nonsynonymous_codon ; L82M Average:76.805; most accessible tissue: Zhenshan97 root, score: 87.558 unknown unknown TOLERATED 0.33
vg1100750967 A -> DEL LOC_Os11g02470.1 N frameshift_variant Average:76.805; most accessible tissue: Zhenshan97 root, score: 87.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1100750967 A T -0.01 -0.04 -0.03 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100750967 NA 3.33E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100750967 NA 1.72E-50 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100750967 NA 4.58E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100750967 NA 8.74E-46 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100750967 NA 8.94E-58 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100750967 NA 6.20E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251