Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020935579:

Variant ID: vg1020935579 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20935579
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGGTGGACGTGGCGATGGAGAAGGTGAGGGTGACGGGGTACGTGGACCGAGGGAGGGTGCTGCGCGAGGTGCGGCGGAGCGGGAAGAAGGCGGAGTT[T/C]
TGGCCCAGCGGCGGCACGCCGCGGCGGTTCACGTCGGAGAAGGAGTACTTCCGCGACGGCGAGGCGTACAGGGGCAGCTACAACTACCACCGCCGTGGCT

Reverse complement sequence

AGCCACGGCGGTGGTAGTTGTAGCTGCCCCTGTACGCCTCGCCGTCGCGGAAGTACTCCTTCTCCGACGTGAACCGCCGCGGCGTGCCGCCGCTGGGCCA[A/G]
AACTCCGCCTTCTTCCCGCTCCGCCGCACCTCGCGCAGCACCCTCCCTCGGTCCACGTACCCCGTCACCCTCACCTTCTCCATCGCCACGTCCACCTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 39.80% 0.47% 0.04% NA
All Indica  2759 91.10% 8.40% 0.40% 0.04% NA
All Japonica  1512 7.50% 91.90% 0.53% 0.00% NA
Aus  269 55.40% 44.20% 0.37% 0.00% NA
Indica I  595 96.10% 3.00% 0.84% 0.00% NA
Indica II  465 71.40% 28.20% 0.22% 0.22% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 89.60% 9.90% 0.51% 0.00% NA
Temperate Japonica  767 8.30% 91.00% 0.65% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 18.70% 80.50% 0.83% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 46.70% 51.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020935579 T -> C LOC_Os10g39210.1 synonymous_variant ; p.Phe116Phe; LOW synonymous_codon Average:76.636; most accessible tissue: Zhenshan97 root, score: 98.419 N N N N
vg1020935579 T -> DEL LOC_Os10g39210.1 N frameshift_variant Average:76.636; most accessible tissue: Zhenshan97 root, score: 98.419 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1020935579 T C -0.05 -0.06 -0.03 -0.01 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020935579 NA 9.60E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020935579 NA 6.60E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020935579 NA 1.18E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020935579 NA 1.45E-08 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020935579 NA 9.61E-13 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020935579 NA 4.07E-10 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020935579 NA 1.40E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020935579 NA 5.20E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020935579 NA 3.35E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251