Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018666630:

Variant ID: vg1018666630 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 18666630
Reference Allele: TCTTC	Alternative Allele: T
Primary Allele: T	Secondary Allele: TCTTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCGCCAACGTCTTTGCACTCTGGGTTAGGACACATCAGTCGTAGCCTCTCCACCTTCCCCATCACGTCATCGACACGATAGTGACGGAGCACCGCAAGC[TCTTC/T]
CTTGCGGTGCTCATGCTTTCCCTTCTTAGGTGTCGCGTACGCCTTCTTCTTTCGCTTCTTGTTGCCGCCGCCGCCACCACAGATGCGACCGAGGAGGTGC

Reverse complement sequence

GCACCTCCTCGGTCGCATCTGTGGTGGCGGCGGCGGCAACAAGAAGCGAAAGAAGAAGGCGTACGCGACACCTAAGAAGGGAAAGCATGAGCACCGCAAG[GAAGA/A]
GCTTGCGGTGCTCCGTCACTATCGTGTCGATGACGTGATGGGGAAGGTGGAGAGGCTACGACTGATGTGTCCTAACCCAGAGTGCAAAGACGTTGGCGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of TCTTC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	29.90%	0.11%	0.15%	NA
All Indica	2759	97.50%	2.20%	0.11%	0.18%	NA
All Japonica	1512	23.20%	76.60%	0.07%	0.13%	NA
Aus	269	71.40%	28.60%	0.00%	0.00%	NA
Indica I	595	97.60%	2.00%	0.17%	0.17%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	96.40%	3.40%	0.00%	0.22%	NA
Indica Intermediate	786	97.50%	2.00%	0.25%	0.25%	NA
Temperate Japonica	767	5.00%	94.80%	0.13%	0.13%	NA
Tropical Japonica	504	56.30%	43.70%	0.00%	0.00%	NA
Japonica Intermediate	241	12.00%	87.60%	0.00%	0.41%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018666630	TCTTC -> T	LOC_Os10g34990.1	frameshift_variant ; p.Glu106fs; HIGH	frameshift_variant	Average:91.223; most accessible tissue: Callus, score: 93.921	N	N	N	N
vg1018666630	TCTTC -> DEL	LOC_Os10g34990.1	N	frameshift_variant	Average:91.223; most accessible tissue: Callus, score: 93.921	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1018666630	TCTTC	T	0.15	0.13	0.08	0.07	0.09	0.09