Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018300164:

Variant ID: vg1018300164 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 18300164
Reference Allele: GTTCTTTTCAGGACTAlternative Allele: G
Primary Allele: GTTCTTTTCAGGACTSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCACGAGGCCGAAGCGGCCGGCGGCGAGGTGGCCGAGCAGCGTGGCGAGCGGCATGGCGAGTTTGCGGCGCCGGCGACGCCTATTGGGGAGAGTAACAT[GTTCTTTTCAGGACT/G]
TGAAAAGAAACATAATTGTTGCGAATGTTAGGACATGATTACATGAATATACATTTTTCTTAAGCTGAGTGACATGTTCATATAGGTAGAAATAAGGAGT

Reverse complement sequence

ACTCCTTATTTCTACCTATATGAACATGTCACTCAGCTTAAGAAAAATGTATATTCATGTAATCATGTCCTAACATTCGCAACAATTATGTTTCTTTTCA[AGTCCTGAAAAGAAC/C]
ATGTTACTCTCCCCAATAGGCGTCGCCGGCGCCGCAAACTCGCCATGCCGCTCGCCACGCTGCTCGGCCACCTCGCCGCCGGCCGCTTCGGCCTCGTGCA

Allele Frequencies:

Populations Population SizeFrequency of GTTCTTTTCAGGACT(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.40% 0.21% 0.04% NA
All Indica  2759 45.40% 54.20% 0.36% 0.07% NA
All Japonica  1512 86.60% 13.40% 0.00% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 14.30% 85.40% 0.34% 0.00% NA
Indica II  465 66.00% 33.80% 0.22% 0.00% NA
Indica III  913 51.60% 47.80% 0.44% 0.22% NA
Indica Intermediate  786 49.60% 50.00% 0.38% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 67.30% 32.70% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018300164 GTTCTTTTCAGGACT -> G LOC_Os10g34310.2 5_prime_UTR_variant ; 46.0bp to feature; MODIFIER silent_mutation Average:91.243; most accessible tissue: Zhenshan97 flag leaf, score: 95.601 N N N N
vg1018300164 GTTCTTTTCAGGACT -> G LOC_Os10g34300.1 upstream_gene_variant ; 2967.0bp to feature; MODIFIER silent_mutation Average:91.243; most accessible tissue: Zhenshan97 flag leaf, score: 95.601 N N N N
vg1018300164 GTTCTTTTCAGGACT -> G LOC_Os10g34310.1 upstream_gene_variant ; 46.0bp to feature; MODIFIER silent_mutation Average:91.243; most accessible tissue: Zhenshan97 flag leaf, score: 95.601 N N N N
vg1018300164 GTTCTTTTCAGGACT -> G LOC_Os10g34330.1 upstream_gene_variant ; 4833.0bp to feature; MODIFIER silent_mutation Average:91.243; most accessible tissue: Zhenshan97 flag leaf, score: 95.601 N N N N
vg1018300164 GTTCTTTTCAGGACT -> G LOC_Os10g34320.1 downstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:91.243; most accessible tissue: Zhenshan97 flag leaf, score: 95.601 N N N N
vg1018300164 GTTCTTTTCAGGACT -> DEL N N silent_mutation Average:91.243; most accessible tissue: Zhenshan97 flag leaf, score: 95.601 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018300164 GTTCT* G -0.16 -0.09 -0.19 -0.14 -0.22 -0.26