Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018300070:

Variant ID: vg1018300070 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18300070
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGAGGTCCGGGAGGGGAGGCGGCGGCGCTGTGCGGAGGAGGAGGTGGAGGAGTCGGTGCGCGGCCGCCGCGGTCGCGGCGCCGGTGAGCGCCTGCACG[A/C]
GGCCGAAGCGGCCGGCGGCGAGGTGGCCGAGCAGCGTGGCGAGCGGCATGGCGAGTTTGCGGCGCCGGCGACGCCTATTGGGGAGAGTAACATGTTCTTT

Reverse complement sequence

AAAGAACATGTTACTCTCCCCAATAGGCGTCGCCGGCGCCGCAAACTCGCCATGCCGCTCGCCACGCTGCTCGGCCACCTCGCCGCCGGCCGCTTCGGCC[T/G]
CGTGCAGGCGCTCACCGGCGCCGCGACCGCGGCGGCCGCGCACCGACTCCTCCACCTCCTCCTCCGCACAGCGCCGCCGCCTCCCCTCCCGGACCTCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 26.90% 2.48% 2.33% NA
All Indica  2759 91.10% 1.10% 3.95% 3.91% NA
All Japonica  1512 25.40% 74.30% 0.26% 0.07% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 92.80% 1.80% 3.19% 2.18% NA
Indica II  465 77.80% 0.60% 10.32% 11.18% NA
Indica III  913 98.00% 0.20% 0.44% 1.31% NA
Indica Intermediate  786 89.60% 1.70% 4.83% 3.94% NA
Temperate Japonica  767 3.90% 95.80% 0.13% 0.13% NA
Tropical Japonica  504 65.10% 34.30% 0.60% 0.00% NA
Japonica Intermediate  241 10.80% 89.20% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 63.30% 32.20% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018300070 A -> C LOC_Os10g34310.1 missense_variant ; p.Leu17Arg; MODERATE nonsynonymous_codon ; L17R Average:92.645; most accessible tissue: Zhenshan97 flag leaf, score: 96.432 benign -1 TOLERATED 1.00
vg1018300070 A -> C LOC_Os10g34310.2 missense_variant ; p.Leu17Arg; MODERATE nonsynonymous_codon ; L17R Average:92.645; most accessible tissue: Zhenshan97 flag leaf, score: 96.432 benign -1 TOLERATED 1.00
vg1018300070 A -> DEL LOC_Os10g34310.2 N frameshift_variant Average:92.645; most accessible tissue: Zhenshan97 flag leaf, score: 96.432 N N N N
vg1018300070 A -> DEL LOC_Os10g34310.1 N frameshift_variant Average:92.645; most accessible tissue: Zhenshan97 flag leaf, score: 96.432 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018300070 A C -0.03 -0.03 -0.02 -0.02 -0.02 -0.02