Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018297861:

Variant ID: vg1018297861 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 18297861
Reference Allele: G	Alternative Allele: GT,GTT
Primary Allele: G	Secondary Allele: GT

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGATGTCTATTGCACCATGATCTGGTCCGTTGATGGGATACGTTGATGGTTTGATCAAATAAATATGCCCTATTGCATTTCAATATTTCATATAAGCT[G/GT,GTT]
TTTTTTTTTCGAATCATTCGTACAGAGATGTTAACTCTAATCCATTCGTAACAGGTGAGGACATTGCTATTGCTGAGATTGCAATCTCTTCTGTCATTTG

Reverse complement sequence

CAAATGACAGAAGAGATTGCAATCTCAGCAATAGCAATGTCCTCACCTGTTACGAATGGATTAGAGTTAACATCTCTGTACGAATGATTCGAAAAAAAAA[C/AC,AAC]
AGCTTATATGAAATATTGAAATGCAATAGGGCATATTTATTTGATCAAACCATCAACGTATCCCATCAACGGACCAGATCATGGTGCAATAGACATCCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.60%	14.00%	0.11%	0.28%	GTT: 0.08%
All Indica	2759	84.70%	14.80%	0.11%	0.36%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	18.20%	79.20%	0.74%	0.37%	GTT: 1.49%
Indica I	595	99.00%	0.50%	0.17%	0.34%	NA
Indica II	465	50.50%	48.80%	0.22%	0.43%	NA
Indica III	913	96.70%	3.20%	0.00%	0.11%	NA
Indica Intermediate	786	80.30%	19.00%	0.13%	0.64%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	77.80%	21.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018297861	G -> GTT	LOC_Os10g34310.1	3_prime_UTR_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GTT	LOC_Os10g34310.2	3_prime_UTR_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GTT	LOC_Os10g34300.1	upstream_gene_variant ; 664.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GTT	LOC_Os10g34290.1	downstream_gene_variant ; 3686.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GTT	LOC_Os10g34320.1	downstream_gene_variant ; 3576.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GT	LOC_Os10g34310.1	3_prime_UTR_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GT	LOC_Os10g34310.2	3_prime_UTR_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GT	LOC_Os10g34300.1	upstream_gene_variant ; 664.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GT	LOC_Os10g34290.1	downstream_gene_variant ; 3686.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> GT	LOC_Os10g34320.1	downstream_gene_variant ; 3576.0bp to feature; MODIFIER	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg1018297861	G -> DEL	N	N	silent_mutation	Average:56.009; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N